DNA methyltransferase 1 associated protein 1

cDNA: Genbank BC048054

 

hi3721 is in the 1st intron, before the ATG

 

tgtttaaaataaaaattttaacaaatattttttgccagcattatttgcta

caatataaatgttttatttcactgtaatattatttttggcttattttgtg

tcaaattatattctaacatacacgcacagacagtatgtatactgcttaaa

aaataaaggaaacacttggagttacattgtgttgtttaagtgtttttctt

taattttttaaaacagtatatcgccctaagaccactgggctgggaatatg

aaagactatttgatgtactatctacttttgtccgatagtcggcggacgtg

taaaaactgtcctgaagcacggagaaaactaccatcgaagaagAGACCTC

CATTCGCCGATATAGCATTCAGCTAACGTTCTCCCGTAAATAAAAACTGA

CATATATTTTAGATAAATAGACTACGTGTCTTTTCCTCAGgtaagttcta

acttcactttcaatatacgtagagttcgtaaacgaagtctaggtgtaata

catattctaaaagtagttcccgc

hi3721 (3-5)

ctgtcaggttatgttagcttggtaacgcagctcattggttccgatttcag

gtttatcaactctcattttattagtcttcatttacttatctatgtcatac

ccgatcaaacagatccagcaaacaggttttcccatgtaaccccggcttgt

tgtttgtgtttggggaaaaattgtgaaataaactgctgttcagccctagt

ctaacaaagacgtttgttgtttatttgtttttcttctatttgcttttttc

ttcactctatatatatatatatatatatatatatatatatatatatatat

atatatatatatatatatatatatataattatttttttttctgataatat

tagTGCCTGACCATGACGACCGGTGCTGATGTGAGGGATATTCTGGAGCT

GGCAGGAGGAGACAATGATTCAGGACCCATCAGTAAGAAGGACATCATCA

ACTCAGACAAGgtaacccgtcacagatgaggaccaataccaccgagatgc

tgaagattacgttttgcagttgcttccacgattgggataaattggtttta

tatttgcacattcagtcttt