cDNA: Genbank NM_213641

 

hi3736a is in the 1st intron

 

ctcaaaaagcgcgtgacacggacgcgcgctcccgtctgctgcacgggagc

gcgcaaaagggcgcgcccgagtgttgtatcaagtgtgcgagaCCGAGGGA

CTGCATCACAGCTCATTCAATTCCAATCCAGACGCCGACTAGCACAGAGA

CACAGCCATGgtaagtttgcatttaaatcatttagaatgttttacagcta

tccctgatatgcttttaatgtttaactactatctcgtgggcattgttggt

tgttttttctcttaaatgtgatt

hi3736a (3-5)

gagtaatctttgaatcaaatctgtcaattaacgcctccaccgaccgtagc

tgcaggctatgataagtagcgttgattgtcagaaaagcatctacattgtc

ctgtggcagtgaactcactccgtttgtttgtccgcggttataatcttgcg

gctcggcggtctgactgcgcgtggccttcaactactcggatgcgatgaga

ttggcaaaaatgagacccaaaaacaactggcgccatttccccgctcagcc

tcctttatttccgtgcgtccaggcccaggaaaggcctcgaccgcttttca

tcacacactgcatgcaggccctgctccacacacgactggaccgcagcgag

atattaggaaaggcagtgaataaaccaatggccgccggccgcatgtgcgg

ttaactgcgttttcaccggccagatgaagcgcttcctcgaccctgtcctt

tgtctgaacacggccatccgtcagaaagcaccatcgttcgcatttgccgc

accgccgcgactgcgggcgggcgtaaaaacgccgattattcccttttaag

gccgaaagctctcatgtttatactacgcttttgctcttttgaacgcgttc

gttttgcggatatttggcacacatgcacgaacaccgcaatcgtggcccca

ccctaattcttgatgcacagatggtgttggttatttctttgaccaaaaag

aggaatcgacggggaaagtgtatcaggttgattttagatgatattatgaa

ataagtgcgctgggtggcaggcggccaacttaaaaaccgttactcgtgca

tttgcgtgtcgttaggcggcgcgtgcactgactactcttcctggttggac

gtaactttataaattactttgtaaattacgttttattgcgtttgatcttt

ctccgaaattatttgtaacacatctgtatctttgagatgagcacgtgact

gcttttgcgtgtgtcctgagaatatttaggtgcttttacttcctcagttt

ttcgaaagcgcagctaagtcgtcgacttgcttctgtacgtacacgcacac

tgaaaaacacttgtgaaaaggaagggaaatggtgataatgccgcgtgtag

gctgaaggaaatgccggttccggtgcgcgcagtctcggtatgcgagtcgc

aaggaccatatgcaacgtcacagaccgcaagcgacgtccaaatctctgtc

tgtgaggcatgtgatgagatgcgcgatgcaagaaacattttaaacatata

aagtgtctctttattcgagggcccaagacgtcacgtttcctgtatcacaa

cacttactcatttctcattgtgggtttcacttctcagtggacgtggatga

tttacccgcagtgttcgtgtccttgcactcaaactttggacttttgctct

ttaattgtttatggctctaggtgacggataaagacacgaacgccttaaga

ttgagtctgcgtgttttttctaaataaaaggctgtcttctattgctgttt

ttgtattgtaatgcttttaagtttgttttagtagtgttttgggggtgatt

gtgttaaacttatttaacggtagctgtagttatccatacattagctctga

acatggagcattttcatctttacattttaagaatgattacaaaagaccgg

tttatttgagcaaaatacttaatttttagtgtttttaattttaaaatgtt

ttagaagtctactttagttttacatctttaaatgtaaaatatatgaattt

ttaaatcttaaaccagtgtttgcgttcatttttggataataagattagtt

ttttcttttttcattgcactcatttctaaccacaagcatttattcaaaat

cgtttaatccttttttttttaagttgtctacctttttaatgggtttacat

tgcaagtgctaaacttttacaaagctatcaagccacttgaccaaagttca

ccagagggtcaaaggaatattcatgaactatctaaaacatggttcatgtt

atcaagtatccttatatggtggtcatttaaatcctgaaaaaagtaatggt

aataattgatcaaaaggtgtgggattccctctcttccattagccctttaa

tgccccatttctttcacataatgaaacatctcaacacgttcctttcattc

acaccttaaacaaacccggatccacccttcagtcgtgcgtttcctgtaag

tgggccgcaagcttcgtgtccaccatttcacactcactaaaaaaaaaaag

ttcaggttactgccagcgtttgctcatagaataatctcatgaactgaaat

cttgaatgtctggttatgcctattcagcattagccactgatccctgtttc

taatggaaatcagaggacctgagtaggtttataagactggtgtgactgaa

gccattttgatttttcacagaggaatcattgttttgtgatctcccgctgt

agacgagctgtgtaggattggtttttgtagtgtgtccgctgctgttgagc

gttttagacgcatgtgaaagtcttgctttaagtcagacccctcggtgcaa

atttcatcagtgcttatgaggaagtttcccaacgttacttctgttctgat

gtgttggagcgtatctgagatgtcgtgtgactgcagaaagaatggtgcct

tgttcagctgctttttttttcttatgggaaaatggaaaccaaacccttgc

aatgattaatttatcctaaatgttatcgaagttatgttttctctcgtctc

cactgcccttgaagtgtgcggttctgtttctccttcgtcagggtttttct

gtttagtcatttccatcttgcactgcaaaacctggcggcctagtagtttg

gattcagccagatgacatccaagtatcaagttcagtcaaaagggcagccg

gtctaacatgagcagaccaatctgattcaatctctgcactctctcacgtt

cattcatccttgcacatgaattcattctctctgcatgtgtttccagGCCT

CCGGAGTTACAGTGGAAGAGACTGTGTTGACGGTCTTCAACGAGATGAAG

GTCCGCAAGGCTCATTGCAATGAGGAAGAGAAGAGCAAGAGGAAGAAGGC

CGTCATGTTCTGCCTGAGCGACGACAAGAAGCACATCATCATGGAGCAAG

GCCAGGAGATCCTGCAGGGCGATGAAGGAGATCCCTACCTTAAGTTTGTG

AAGATGCTTCCTCCCAATGATTGTCGCTACGCTCTCTATGATGCCACGTA

TGAGACTAAAGAGACCAAGAAAGAGGACCTGGTTTTCATCTTCTGgtacg

ttttcgctcctgcttttctaccctgcattgagtgtttagctggttttctg

gtgttttatcagggttggagctgaaggtagatcttcataagcgggttgat

ggacttgttacagtgtttgtaaaaagcatgggctgatctattgttgttac

tcagGGCCCCAGAGAGCGCTCCACTTAAAAGCAAGATGATCTACGCCAGC

TCCAAGGATGCCATCAAGAAGAAGTTCACAGgtaatgctgtccatcaact

tttatatttattactggataaataattcatgcctatacaaataaaa