chromosome 21 open reading frame 59-like

cDNA: Genbank NM_200088              

 

hi3764 is in the 2nd intron

 

GACAGTACTTCCTGTGGACAAACAACACACTGCTGCTGCTTTAAACACGT

TCTTGTTGATGCACTAAATGAAAAgtaagtattgtttgtacaactagaca

gtatacaatattttacggtagttatcgaaattattgcctgtattattagt

gtcactcaaacacacgttgtctgctacgtgctcgctcagcatgctagaat

attcttgaacacgatagtgtcggtgccatgacaacaagctcaaacacagt

gaggagcgagttggcgacatagaacacttccccgtggtcaggttttactt

tctgttaaagtctcatatttatataacacgcgcacacagGACCGAATCCG

CAAGCGAGAGATGGTTCAGCTTCACGTTAAACGGGGAGACGAGAGCCAGT

TTCTCTTCAACACTACGGTGGATGTGCAGATTGAGACGCTGACCCAGCAG

ATCTGCGAGATCTACAATGCAAGACTGAAAGTGGACAGAATCTGCACTGg

tatgactgatctttacgtgttatgtattttaatagtgttgaacggtataa

atgcatctttcgatttggtttaacagttgtgtcaggtaaaatttaactag

cgttattacactgtaaaacccaacagtcaactttaccgaatgaaatgagt

gtaacgttaatt

hi3764 (3-5)

aactcaacatttactggaagttaattctactcatttgaaaagagttttga

actcagcgttgaaggtaatacgtaaattaaatacctcattacttcaactt

aaatggagtaagttcacaatactcttatagattagtttaactcaaatggt

ttgagttgccttaacctattgggttttacattactcaattggttggagtt

ctgtttactgtgctcaaatagttctatttactcaataaattaagttcaca

gtactcattgggattcgtttttgaacttaaatgattttttgcaatcggtt

tcctcaaacggtttgagttaccttaactttttaggttttacagtgtagta

gaagtcaagtattgagtgtattatgttgcgttagtttacccgaaactgaa

aattctgtcatcatttactcaccctccacttgttccaaacctgtttgtct

ttctcttttctgttgaacaaaaaatatatgaagaaaactggaaacctgta

cctattaatttccattcattcattcactttcttgtcggcttagtcccttt

attaatccggggtcgccagagcggattgacttattcagcaggttttacac

agcagatgcccttccagccgcaacccatctctgggaaacatccacacaca

tacactcacacactacggacaatttagcgtacccaattcacctgtaccgc

atgtctttggactgtgggggaaaacagagcatcctgaggaaacccacgcg

aatgcagggagaagatgcaaactcaacacagaaacaccaattgagccgag

gttcgaaccagcgaccttcttgctgtgaggcgacacgacagcactaccta

ctgcgccactgcatctccccattaatttccacagtaatgtaaaatgtttt

ctttctgtggaagtcaatggttaccagtttttagcagaataaagagaaac

tcgtaatcttttatttttttaagacaaatacagtgcttctgatttgtaat

tgtacacaaaaagcagaggtgtccatactcagcatgtatgtttttacaaa

ataaaagcctactaagagcttaattcgcttgccctgttgtgtctgattag

ggttggaactaaactttgcaggacaccagcattccagggtttagaccccc

caaatgaactctgcatttgtgtagctttcatacaattattactatggtca

ctgtgttggaattaaccttcaataaatccttctcaaaatgtaaatgaggt

gtttttttttttttaagttttctttttttgttaatccacaatattcaagt

caatgcatctatcaatccattttttactttccaaatggtatgttctgagt

ttcataatttatatgcatatgtctgaactcaaaggggtgatggttaagag

gtgaaatattatagaataataaatttgttcgttactaagtattaaaggga

ctgttcacccagaagtgaaaatctactcatgaattactcaactttaaggg

gttccacttttttatttaatttattttttttactactgtttaaatacaaa

agaagatattttgaagcaagctggaaacctgtaaccactacataaagaaa

tgacatcaaagaaatgcataaaggtctggaatcgcttgaggaacagttca

cccagaaataaaaaagtacttgtgatttactcctcctcaagtggtttcac

tttgtttatctctattgaacacaaaaaaatattttgacatccatagtaga

aataaaagcactatcgatatcaacagctaccggttttctacatttttcat

aaagtcttgttttgtagtcatatggataaataaacttaaattgggatcaa

gggtgggttaatgctgatagttcacccaaaacgtctctttaagttcatcc

atgctacttttcatttgtttacccatagAAATCCCAGAGCTGGCAGATCA

TGGTATCTCTTTACCACCAAATATGCAAGGCCTGACCGATGATCAGATTG

TGGAGCTCAAACTGAAGGATGAATGGGAAGAGCGGTGCATTCCCAGTGGC

GGTGCCGAGTTTAAAAAAGATGAGATCGGACGTCGAAATGGACACGgtat

tagtctgtcacatttatctgtttattactatacattttcttatatatgtg

tataatttatgacaccttaaatgacccaagaattacaaaaaattcttgat

ttaaaa