KFZP564C186-like (id:ibd5110)

cDNA: Genbank AY648837

 

hi3773 is in the 1st intron

 

aaagATCAACTGAGCTGAGTTCCCTAAAGCGTTGCATTGTGGGTATTACG

TCTCAGTGCACGTTTTTATCCAGCATGGCAGGGAAAAACAAGAGgtatgt

ctaattcgtatctatttaatctcgtttaaatagtagcatattattgtttg

tgtttcagtacagataacttgaatgtatacgggggtgtcaaaccctagtt

cacttcataagacgcttctttggtgaaatttaacggtagctagctagttt

tagccactgaagatgggtcagaactcataggttttgtattagtttagtat

atacattttcagttttgtgtcttcagtgttcagtgattttattgatgcgt

ttttttaaatcgcgttcatgatgtattacattttaatagaagggaaatta

tctgaacatgcagcattgataacatactgtgttaaaaatatgtatgcatt

tgaacctaa

approx hi3773 (3-5)

gagctcttttttattttaaataattaatatattgaaataggagtaattac

agaagggtttgaacattttactttacagatattcctaaatataatcgttt

tcgtgtaaagatgctcatgtcatatatcatactgactgtagtattgtgct

attatgtgtcatctattaaaattaaatgttttattttagtcatattaagt

ctcatttcattttaatcagttgtgatgtatttagttattcaataaaaata

tataatagaagataattttgtgagaactaattaatatattattattaatt

ataaaaatatgtttactctctacagcacttagtcaattccaagagtgctt

gacgagcaaatgtaatcaaaacaagctagtaaaagatacaatcccaaaca

cataattcctactatggccacaaatatatagactaactgtaaacaaaaaa

aagattggatgctttcatgatatctatgttatgtttttgcagAAAGTTGG

AGGATCTCAGTGTGGATGAGTTCATGTTGTCTGGGTTTGATTCTGATGAG

GAAGATGACTGTGAGGATGAAGAACCCTCCCAAAGAAAGGAAAGAGCAAA

ACGCCTGCACTTCAGAAAACgtaagcaaatgctttacattcagatggtca

ttccagtgttctgggcccagtttttcaaaaggtttaattcggataaaatt

gatccggatttagtaatcctggttttgcgatctgtgatctcgtaatccag

agataatttttgagccagtttttcaaagtaaagagcaacaagtagaatag

ccagtgtggggtcaatataactttatttttatttcaaaagataacacaca

catttaaaaaaaaacttaaaacaagaaaaaccccagcccatccttgtaca

gcaatccgctcatctgagacctacaacacaaacatttgaggatatttaac

aagtttcaaatatagatgtattgaattaaaaattgaatttttattttaat

tttttattgaattaaaaacgccttaatgtcaaaacctccacaataatttc

agacttcctcatctgatgtggagagagcagcttgtctgagcgtagccttt

aggagtcagatct