tubulin, gamma-like

cDNA: Genbank BC045486

 

hi3785 is in the 1st intron

 

tgcgtaactgacgcgcagctttgatgttgttcaatataaacgcatacata

cgtcttgaaatacgtcggtagtgccctctacgtttatgtcttttttcttt

tacatatttgctgttttccataaaaacgtattttgttccatccttacaaa

gattgatctagttagattacagagtggctttaaatttgtaaagttgccgg

agtttgcgcatgcgcagtgggcgtccgataggccgttgctgtTGGAGCGG

GAACACGCATAGTGGTTGACTGACAGCAGAACGTCTCTCACATTTACTGA

TCGTACAGCTGAAATAACAGCAGGACGGGATGCCTCGAGAAATCATCACC

CTGCAGCTCGGACAGTGCGGGAACCAGAgtgagccattttcctttattag

gctttgtttgccaacaagagcca

hi3785 (3-5)

tctttacataaacagtgtacgttagctagctaacgttatccagctaacgt

tatcacactgcacagctttaaaacgacaccataaataagcaacgtaaata

agatcagaagatggtttgattgtttacagtattttttcagctgcaggaag

ccaagtactttcattattttccatttaacactactgtctgttctttgttt

gtgtttcctaatcaataaaactaaacgtggtaagttaacgttatgcttgc

tttgtagtaacgttaattaacattagtcaatttagtcacattggccgttt

tagaaagcgggaatagagttgtatttatttataggtggagacggactaca

tccatcatagaagctgtaaacagtaacagccgttatgttgctattattca

acaacgttacatatagcatttcccagtagctttgtctttgagaagtgttt

tttaaacatcatgcaatagagtacttgaataaatgtagtcctcattgtct

ttctctgcagTTGGTTTTGAGTTTTGGAAGCAGTTGTGTGCTGAGCATGG

CATCAGTCCAGAGGGCATCGTAGAGGAGTTTGCCACTGAAGGCACTGACC

GGAAAGATGTCTTCTTCTATCAGgtactcaaatacagaatgccaattatc

taccataatcgcat