small nuclear ribonucleoprotein F

cDNA: Genbank AY648838

 

hi3808 is in the 1st intron

 

aatttcagacctccactccagctcaactgaggattcacggCTCTATTCCC

CGCCTGTCCAGCGAGTGGCGCAGCGGGCAGATCCGCTCTTCTCTCCTGCC

GTGCGGTCAAAGTGCGCTCGTAGTCCTTCCCTCTTTCGGCGGCAAGGCGT

GCGAGTGTGCTGCATTAGCTTATACTATTCAAATAAACAATTTTTGTGTC

TGAAAATACTACTTAAGTAATCCAGTCATGgtaagttcatcgttatctct

tttatttgtatccaaaccttcagtttggcgaaagagcgtagacgttttca

ttcataaatacgctgataatgcggctaggtgttagcatcaggaacgcaga

ctggacgttgttttcagtcattttcagtgttgtgttagaaatgttgagct

ttgctgataaatgttcctccttgttctcttacaacctagtcggtgactcc

caaaatgcgattaaatgatatatgtgtgggaaaactaaagataaaaacta

acgttaaaggagttttttctgctattactgatgcttattcgcagctaatt

ctggtggaaaccaaacacaattaatgctgtaaattattatattgttttat

tgaagttacacaatatatatatatatatatatatatatatatatatattg

tgtgtacgcatgcgtgttttgattttttacaccacaaactacagtaatga

gaatttgtcatcacaatttaaaatgaagtcatatcaattgtatctgtttt

tgttttgtttttattatttgtttattttgcttgtgtaaattcatgcggct

agtgtca

hi3808 (3-5)

aaactttttactaaaagttataacaagctgatgaagaaaaaaaactaaaa

cccaaaatgtaaatctttttttttttctatttggtcaaatatgactgagc

atcaccgcaggctatgctaaagtttcttctaagcttttcactcacttgag

aataaaatcatcaacatttgtagtattttacttcttcaggaacaatatta

tgttgacatggaattgtttgaaaatgacacttagggattgatttcgaatg

atgttaattgtgtaacactgatcttttccctcagAGTTTGCCGCTGAACC

CAAAGCCCTTTCTGAATGGTCTGACAGGAAAGCCTGTGATGGTGAAGCTG

AAGTGGGGCATGGAGTACAAGGGCTACCTGGTGTCAGTGGATGGGTACAT

GAACATGCAGgtatgtttaaaagagttaacgattctatgaaaatccagct

ccttagtaggaagaaaatttaaactattctttttaactcgagacataccg

ttgtatatgccattatggagatgctagacacacacagacatctgcttaaa

gcagaaggtggccaaaaatgtaaatattgtaatggcaacctagctgtcaa

gcatatacacttcatatgaaaacctcaatatttagcaattctgagtgtgc

cttacacaagtgagtgggctttataaacactccttgacacacttgcacta

gttttgtctatttgtaccagaccctctctttcaaccacttcatagctcta

taaaacattgtgcatttctagat