WD repeat domain 68

cDNA: Genbank BC053157

 

hi3812 is in the 1st exon

 

tatccgggacttttattttgaaacgcagacacacatctttcagaccaaat

gcgccgttgagcggtagggcctatttagggctttctaaagttagaattaa

aaccgtcgggactaaggaaaaacatggccctttagctacacgcagttatg

aatgtttgatggttatttgcgtgttttattaggcaggaatcgtgctgttt

tgtaggcagctcgtcgttttcgcggccgttgcggagagggattGTTATGA

CGTTCTCTTTGTCTCGCGCTGCACAAACCCGAGACCATATTTATCTCTGT

AAGAGCCTTTTTTAAACATCCCGTCGAATCAAGCTACTCCTAACGACCTA

ATTCTCTCTAGCTGTCGCCGATCACTGGGATTGAAGCATGTCGTTGCACG

GTAAACGAAAAGAGATCTACAAATACGAGGCGCCATGGACCGTCTATGCT

ATGAACTGGAGCGTCAGACCCGACAAGCGTTTTCGGCTCGCGCTCGGCAG

CTTCGTCGAGGAGTACAAC

hi3812 (5-3)

AACAAGgtaaacacctgctgccacacaacactatgctttatgtctgatct

tatgacacacgctatcatttcacatagtgaagtgtgtagcctaaaaacat

gtaaggtgcaggttattccacagtgttggaattttaacgcgcaaatgtat

gacagacactaataattgtatattttaagcgactgttattttgtatcttg

tatttagcgtgtgcgaattaaaggttacgaataggttcgtagaggacaaa

atgtctgtctaaaattcataatagaagtatatctagggctttcaaaaccc

tttcactgacagatttttctgtaccacccgcaccagtcctgatgataatt

gtcagaaaatgcaataattttagacatttcatttaatcattaccactgtt

tttttgttgtgtttttttgtggaa