epithelial cell transforming sequence 2 oncogene

cDNA: Genbank AY648840

 

hi3820a is in the 1st intron, before the ATG

 

tattatggtaacgcctgtgtgtgtgacactgaacagttatttaacttgtt

ttattgtttattacatttaaacattaataaaaaaagtcaatatatttcat

ctatatgttccggtatagttttacattaagtaattaattattttttttgt

caaaaatcatacatcttactatccttctccacggaaagaggtgctgtgct

gactgactccagtccacttcactccactacatgcatcgccgtttgaatgc

aacagccaatcagaggcgccgcctcagaacttccgtcgagctcgtcactc

ttatccaatcaacgcggggctctcatgttTGCTTGCTTTTTTGAATTCAC

CGAGTTAGTTGAGCAGAGCCACCTATCAAATGAGCGTATACAATGGGCGA

ACTAAACTGGTTTCCATAACTAATTGTTATTATTTTGCACTTTGGGCAAA

TTTTACTTGTCATTTGGAGGACTGTGCGGGTTACGTTTGCAACTGTTAGT

TTTAAACACTACTTCGCCTAAACAAAAACACTGATTGTTTAGCTGGTTCG

GCAGCCAGCTGAGCCATTAACGTTAAGTGTTTCTTCATTTTCCAAAGCGT

TTCCAGAACACATCAGGACATATTCATCTTTCATACGgtaagtttttttt

tttgcaaacttataaatattagcttggaactaaaaactaaatattgcc

hi3820a (5-3)

gaagagaatttattttgtttagaagttagctagcgagctagcgcatgtca

ttcagttgtatttgcagctgccaatcagctgtcatagcgttaagttactt

tatataaacctggcagatctgaaatatgtcacttcatttgttctatttta

tattaatacttgtgcatatactatagttgtactgctatatattcattgaa

aggcgtttcacctgtacattcatggtttctgcgtgtcttccttccacaat

gtctttttaaaaagctcagagcagaaaatctgaaactcataagttcgtac

attacatgtaaataattgatgtttttctcaatacattttctaaacatcac

cgaatcaagataaatgtacttgggacgcaaatacatgaatcaaagttttg

ttttctatgaatatgaagtttaaaactagaacacatttctgaagtggggt

aagaaattaacttttccttcaaaaccgacttaaattcatctaatcataat

cataaatctgctttacttttatcagtttcacagacctcatttagttattt

tgcttcaagttaacaggctttctgaaaatcttcaaagcctaagtgaatat

cctcctgttttctttccaataaaaacggattagacttccttcttgtcata

gaggtaaagttggttttatattcacacattcagactttccccttaataat

acaacttcataaaagtattacttttaaactctaaatgcgaaatcatatta

acagccaatgactatcaaagtacaacgttgttcacaggcaaaaacacagt

gttaatgttgttttcaagtcatacttgctaattccaatcgaaaattcaaa

gtaacatagtaaacaatatggagacttctaaatgaacgaatgcccaaata

taaaaccaactttaactctatcttcttgtctagatacatttatgtgatca

tataatgtatcgtctaaactgtaaaaagtgctgaactgcagaaatcaggc

actgtttttttaaaaaaaagatcaaaattaagttattttgtgctcctaac

gaaaaacaaattatcagtggaacatgaaaatgacatttgaatcaagtaga

tatttttccattgacacatttgttcttgttttaattattaaaactgattt

cacacacgggctgcacggtggcgcagtgggtagcatgtgcgcctcacact

aagaaggtcgctggtttgagcctcgactgggtcagttggcatttctgtgt

gtggaatttatatgttctcctcgtgtttgcatgggtttcctgcacaagtc

caaaaacgtggtacaggtgaattgagtaagctaaattgtccgtacacact

cagaaataaaggtacaagagttatcactggggtggtacctttttgaaagg

tagtgtatgtgaatgaaagtgcatggttgtttttcagtgataggttgcag

ctggatgggcatccactgcgtaaaacaaacgctgagctgaagttgggggt

tcattccgctttggcaaccccccagattaataaagggactaactaagccg

aaaagaaaatgaatgaatgaatttcacattcaagacttctttttgatgtc

attttacttcatatcaaatgtattaaaattaaatcatcttgtcttttgca

cctgagattaagactaaatactgaggaagaaagtgtattaaatctttggg

atatatgcatgtatgtaaaaaagaattgaaagaatgcaatcattatgaat

aattgttttagataatgcaaaaaagtgggcatatgcacacatacttttaa

tttctggtgaactgaacttccattataaaattgccacatttaatgtctga

tttctttaaaaatcagtgatcttcaatgtctgatataaacaatataaagt

tggactcggataagaagcactgcattaatgtctttaaaataagagtttgt

tgtaccgtagtacttccaatgaagtttctgtgctcgcctgctgatcctga

tggcgctagtgattacatcttccatatcgttttacgcttgaacagctaaa

tgaatggttaggtgtatttaactgaatgtatagtgattacattacatcaa

tgctgtaaaaggaaccttatgaaattcaaaatagttacattaagctttca

ccagaagtttgtcattggctaaaaacattaactgtccatatagcccgttc

acatttggaaagcaaataaacctattatgttcccatcaaattatttagca

ccttttctttgcttggtcttttaaaataagtctttcaaatatttttgcct

tcctaaaacacccttaaacctatatatgtttatggtttgttactattttt

ttttagctttaatgaaaatcaacatactttttgtaactgttatatattgc

attcagattaaaaatgtgatctgctactggtaagttaagatcttaaataa

acatcaagatgatacatttttcagtagatttatattgactctctccttcc

tgtaacctttattgtctcctttactgttggtgtcttatttttgtgcagCC

CTTGTTCACTGCTTTCTCACTGGCCTCCAGTTTTTTTTTGGAAATTCTGG

ACAGGACTGGGTCACCACCCCTTGTCACAGCGCCATGGCTGACAGCAGCA

TACTTACTTTAGGGCCGGGCCGAAGCATTCTGGTGGACTCCTCCGTGTAT

GACTCCCGGATGGCCGAGACCTCAAAAGAGCAATATTTCATTGGTCTACA

CTCAGACGAGACAGAGGgtaagtgaaccgccctccatctctatcaactga

catttctgtagggtggactgttttactgcgcacaaacataacaaaaaagg

ttattttttcattctctttccatagagagtcaccatttcctgtggtcttt

tatatttttttttatagGTGTATTGCCCAGAGTTGAGACCAGGGTGGTGT

TGGTTGGGGAGGCCTGCAAAATGGCAGAACTTGAGAAAGCTCTTCAGgta

ctgttagaaagattgatttctctgtgaacagcagatgtggttgttattga

gagatttttaatgagatgaaacaataattcagaagtgttgcaagaacaat