60S ribosomal protein L11

cDNA: Genbank AY648841

 

hi3820b is in the 1st intron

 

aaaagatagccctccaagtttctgaaggatatattgaggaataaagaacc

aaattaagtcatgtcaaataaatttaaagattatttttgtcttgtgaaat

gtacgggaagcacaacctttatgtgcgaggaatgctgggtagtgtagttc

tctggacgcaaaacgcagcataaatgctttgcgccggaagtgtatcGTTC

TCTTCTAGTGATCAAACATGGCGgtgagtacagcataaattgtgtcctag

ccggggtaccgttaaaatcactaaacatctgcttggtttcacgcaataac

cacacgaagcacatcgttataaatcgctacagatttgacaaacagaataa

cggagttattagtggccagaatagtcggatgaggctaatattaccgctag

cttcagaatgtgccgaagagccccaacggcacgtcattgaccaatttaaa

gtacacaacgtgctaaaatacagc

hi3820b (5-3)

ttagatagttttttactattatatgtacagattccggatgagcaaataac

ttatgtcctcgttaatggttattatttcagctaatgtctgtgctagcgga

tgggataacctagtgctggatatgtccgggcatgttcatttcggacttct

gtcaataataaattagcgtttggctcgttaaagtttgtctaataggtgtt

ttaagattatacaccatcagtaagtgttaaaagatgcagtgtccttaatt

gctgtgcttgttagtgttattttgagagatggtgcaggtttgtgaagggg

tctctatcctgacagctcattatttaacttgactatattgaattgcactg

aatatgagcgagaattgggtggagagaaaggaaagtttaaagtcaaattg

gtttcatattcaacacattcgtacatttttgaacagtgacaacgtgacat

ttacatataacgttactccttttgcactattatcactcttgttttagata

ctgtcttggatatttctttatatattgcttgtttgcaccatagactgaga

gaactgcaacttcatctgtgatgtttatcaagaatgttcagcatatttga

caataagacttgatcttgcttgccatcctactttgaatattggtctgagt

ttaacttgctgattttataaaaccaactttaacaaaattgcatcatttaa

catcattaataatcgcacatttgttcagtgacaacgtccctatattgttt

accatgctactttgaattttcggtctgaaatcgcatgtaatatgacttaa

taacattagcaccatttaattgattgggaacaatgttgtacttttatagt

cactggctagtgatttccctatttagtctatgcaaagaatgctgaaatta

tattaaggtgaccaaatttacctaaagttgcctactaagaccttgattaa

attattcaagtgtgtttgatttgggttttagctgaactctaccaggacac

ccggcccttgagggaataagtatggtgaccactggtctttactgacagct

cattatttgtctgttatttaattacacagGGACCAGAGCGAGAAGAAGGA

GGACCCCCATGAGGGAGTTGCGCATCCGCAAAATGGGCGTGAACATCTGT

GTGGGTGAGAGCGGTGACAGACTCACCAGAGCTGCTAAAGTGCTGGAGCA

GCTGACAGGACAGACTCCAGTCTTCTCCAAGGgtgagtggcattttcttc

Atccaccaccagtgtgcagcgtccacctggatgatgcaa