chaperonin containing TCP1, subunit 3

cDNA: Genbank AF506209

 

hi383a is in the 1st exon

hi1867 is in the first intron

 

agatgtctgtcaaaggcatctcgtttgctaattggtccactctgttgctc

agttctcaaccacgcctcgtgcatcctctcctcttgccgttgtgcgcgtt

GTCCGGTACCGGTGATCTAACCACGCCGCAAATATGATGGGCCGACCGGT

TCTCG

hi383a (3-5)

TGCTTAgtgagtgcttattttaatactctatctttaaatctattactgga

gctatcgcatgagccgccgctggtctctgtagcagtcaaaataagaattt

tattcatgcagctttgcttga

hi1867 (3-5)

atgctaagctaactagtgtggcacgggggcctcgcgtgtctgacaagctc

atgtcagtgttcagattagtcattgtgttagcctcttagctaacatttac

tggtataactgtttaagactttgcatctcaagttgcagagtcaaaaataa

atctagcgatttttagtttctagtcatttgctggcattgtagtttctata

taacggacgctttaaaagaatgaattagttagcatcaggctaacagcagt

gcgtagagggtgggcttactaaagctgcacccttttcgtgttaaggaaca

gatttgttgtattgtttttcagttgtcttggcttggtgttaggttttaag

gcagtgaatgttatttgaatttttttagtgaatgaagagtttagagttca

tcatatgaagaagcagatttaatgcccattggctctgtttttggtacagG

TCAGAACATCAAGAGAGAATCTGGACGGAAGGTCCAGATTGGAAACATCT

CTGCGGCTAAGgtgagtctatgtttagtttattgtatatatatgtatttt

tttgttattgcaacgttgcctacatgtcacataaatcatatcaccaacct

gacttgcagtcttctgttcccttttttagACCATAGCAGACATCATCAGG

ACATGCCTAGGACCAAGGGCTATGATGAAGgtgcgcttaagatgttcacg

ttatcattttcccaagtgaatctttgttatagaaagagataaaaatatgt

tttgtctgcagATGCTGCTGGATCCCATGGGTGGTATCGTCATGACCAAT

GATGGCAATGCCATTTTGAGAGAGgtgatttgaaccctgctacattatct

gtgagttgttaaatgaaatctgtatcttga