family with sequence similarity 32, member A

cDNA: Genbank BC072708

 

hi3885 is in the 1st intron

 

gttctctagagggcagtaaatccgaggaaaattgataaacaatcctgttg

ggacgcaagctagtctgatacaGACAGAAGCTGAAATGTCGGAGTACAAG

TCTGTCCAGAAAGGCTCTTTAAAACTGAAAGGGGTTTCTTTACCAAGTAA

AAAgtgtgtatttgtttatgttagtttttaatatatcaaaacaactatta

cgat

hi3885 (3-5)

atttattttgggaatgttttgccattgcctgacacgccagctgttagctg

ttatgctagctctgtgttgttgatcgacttaacatcgttgttaatgtgat

caattttcatgttgtgttgttttttttagGAAAAAGAAGAAGAATAAGGA

AATGAAGCGTTTGGAGGAACAAGTTTTGACCTCTGAAAACGAAGAAGGAA

CTAAAAAAGCTTATGTTGACAAAAGGACACCAGCACAGATGGCATTCGAC

AAAATACAAGAGAAAAGGgtgagtatc