60S ribosomal protein L28

cDNA: Genbank NM_201061   

 

hi3893 is in the 1st intron, before the ATG

 

agatcttcatcattctccatcactgctgcactgagtgatgatgatggaag

attcgcctcttaaatacgttagtcatacgattaataacctcatatgtctg

gactccgctgtcattttcgcaaactaactgtcctcagttgagtattaata

ataataacaataacaatgtgtttacagaagacatcggtgctggtttgttg

tggttcgcagagcgcatgaaagtgacgtagagcacgcagagcgcatgacg

tacgcaaactgcatcactcgcagtccgaaagattatcttcatccgcactg

tgcctcagacaaatagtcccgttgaaaaaaatattttatcgtaatgaaaa

ttatattaactcacaaaaaaatctaaaatacatgtgaagtgtatttaaaa

caatatagactctgatttgattgtgaattgacatgttactactcttcaca

taggcgcgcggaaatacataatctctaacggaactggaactccttccTTT

CCCTCTCTCTTCCTCTGCACAGAAGgtaacgtggtcgtcttgtgtagctt

tttagcgaccgaataaactcgttaaaagcatacatttcagtataaaatac

gcgtgggatgtgttatgagcggtttatgaacgctacccttcggtgtaagt

tagtggaaataaagagaaaggtgtttcactataaacgccgccggtgttga

ttagcgttagcgtggccttcattgagcacaccgctatatatgattaaaac

aacctagaatgagtaataaagttatgatttccacccagaattggtacatt

aacggttgtacgaaaattatgatgcgtgattttgacattggagtgacgta

aagttggttttctactctcacattaattcag

hi3893 (5-3)

tgacaacttgtgacatgctccctagtgtttactatagtaacgttactgtg

aatattcggtgtaaaataccatgtaagagtcactttaagacttcattagc

tccatttagttgaccgtaaacaatggtgcacttcggtagtcattgctagc

aaatataatttcactaattagcatttttgtaagaatactttactataatt

aaaagggtggaagtccatatgtgtgaatatgtaacttaacctcaacgatt

tgtctatttatgatttttaacgcatatttcaaagtggtagtttattgtga

ttagcgaggttatttggatttactgacatctgagcagatgttaactatta

taatgagtattaatggatttgttttattattattggttcagGACAGTCAT

CATGGCATCGCCTCACCTGCAGTGGATGGTCATCAGAAACAGCTCTAGTT

TTCTCATCAAGAGGAACAAACAGACCTACAGCACcgtaagtagcccagat

ttaacaccagtt