clusterin associated protein 1

cDNA: Genbank BC045921

 

hi3959a is in the 1st intron, before the ATG

 

ttattcagcacaacgctttagtttattgtcaaacagagtataatgttcaa

tttttgtcgttgttttgtgagttttgcaggtctgtgagctcgttgtgttt

gtaataatcggctctgctcgcgctacagagaccgccgcgacgtgtttgaa

cggcatgacgcaagacgtacgtcacatgcacaaaaaagtaaattaccaag

atatttgtaatttatttaattttatataatttataagcatatttgtgtta

tcatggtgatgtttcgtgtagatagaaattgacagctgatatatatttaa

ttgtgtacacagtaagcatatagcgaagcacagaaacacagcgaagcatt

agaaaataatgcaaagataactttttttagcttatttattatttattttt

tacatgaattgatttattgtacatcttagatgttgtttgtatatttacat

atcatgatccgaattttccttaaaaaatattcactgttgtacatttaatc

tgataaatgattatacggtgtatatagtaactatataatgatatttctga

ctagtcacaaatggttctaaagtaatttcgcgataatgttttagatcatc

atctgtaaacgcgtttttctagtttgtggttattgggcttccgtagggtt

gcatgggtgccatagtgacgaacacagcaacagacgccttttcgaggcaa

aaacatccgctttatATGCTAATCATTACTGTTATTTTTACATGATTTAC

AACTAAAACGgtaaaggttttgttatattcctccattatcagaatttagt

agttaattttaggcggaagacaaaagatgatgctcaagctactta

hi3959a (5-3)

acgtcatcatgctagctttaacagttgaggctaaccacattttccagtga

agattaactttaacattagacaaatgcaaaatgccgtcttttattgaagg

aaatgtgtgactactcgctttcagtttgagtattcaatatctgtgcatga

ataatttaattgtataattgttttacgttttgttaatgaaatgtgtattc

attcttcttgtcttatagGTGACAGTTGTGTGTTTACTGGATTAAAGGAC

AGCAATCATGTCTTTTAGAGATCTGAGAAgtaagtgaccccaaatccatc

aattactgtaaaatatattctagtgttactctgtgctaagttaagctgtg

gtttgtgtttatgtgattatatatgtcagctgaaatataatattacccta

ccgcatgcttggaaaggtttcatttctggtgtttttacaataatatattt

gtgcatgcacattagattaggcagtaatgaagacaaatctaacaaaataa

cttgcaataactgtcctaaaactagtacacccaaatttgttatagaaaaa

tataaacaaaaatttcaaaaatagtaaaaatcaagcgaagcaaaaaattg

aaattatcttgttgagattttgtaggttgtatttttttttttgctatatt

taacttgaatttaattatattatccttcaatttctaaatatctttggtga

ctaaaatattattttaataaatttatctgttaaataaatctgttttgttt

aaatgcaccaaaatacatcgcctatattcactgagaaatggagaaaaatg

aaaaatattcattttcaaaatggggtgtactcaattttgctgaggtctgt

atatacataagagc