S-phase kinase-associated protein 1A

cDNA: Genbank NM_200743

 

hi3970 is in the 2nd (1st coding) exon

 

cagttactcacgctgagctcagactcattcaggccttgttGACGCTCAGA

CTCACAGCTTGATCGCGCTCCCAGACACGgtaagagcagcacacagtaca

ccgcattaacatgcagtgtgttgtactgttataatatgtgtgaagttgtg

tgaaataacgctgtttaagcgctggtcgggatgaaaacagcggttgctat

gagaggcctgtatccgcgcggctaacgctagcctagcatcacaaaccgct

gaatttaatcatcttctactgttttctccacaatatcaaagctgttttga

agcatttactgttagatttggtgatttgtctgattaaataataatgtgtg

tgcgcgttggagatttgtaaatcaggaaatctggcgtgtctgaagcgcga

ggggttttctatgtcttctttctcttgtgatcgccatttgttgatgtgtt

tgagctatagctgatcaatgtaagcgaacactgctgttttacctcatgac

tgactcccataataatgtgtgtgatcgataatacactgtgttgctcatac

agATGCCGACCAT

hi3970 (3-5)

TAAACTGCAGAGCTCTGATGGAGAGATGTTCGAGGTGGATGTGGAGATCG

CCAAGCAGTCAGTGACCATCAAGACCATGCTAGAGGgtgagggacatgtc

tgttctcatgtcagatctctgtatgagctttatatgtgctgtgtgttgtg

tgtatatgagatctgtggtgtgtatgggagatttagtagctttatgatat

gtataagtatgcttttatgacaaacgtacacacacacacacacaatgcac

aatacataatttccatacactatttggggtaaagttggtttataatcaca

cattcagatttgcaccttttaatataattttagaaaaagaaacgttttct

tagataattccaaatagtgaaatcatattatcagcttatgaatatgaaag

tgcgacagtgctgacactcaattaaatcaggggttcctaaacatttcagc

ccgcgacccccaaaataacaatgtcagtgactcgcgagcttcatttttca

agttagaagtaaagctggttttatattgagatattcagacattcttctta

ataatataatgtca