nuclear respiratory factor 1

cDNA: Genbank NM_131680

 

hi399 is in the first intron, before the ATG

 

GCTCCGCCGCACCGCGCAGGCCCGAAGTAGCGCAGCCGCTCTGAGgttag

tgccctaccgcgcaatctccagccatttcagccctggcgcagccgcacca

aacaacccggcagcgtttgcctttcacacactcagatgcagatcgcgacg

atgcgaaacagaactgcagatgatttcgagcacttttgcccggatggcaa

ttattatttaccccgctcaatttggggcaaaaaaagaatcatggcgcagg

cgcgggcctttggcctaacgtactgaatttagatgtgcaatcgaatcgct

approx hi399 (5-3)

tatgttttttgtccagatgctaaatgggatttcagtgcttgatagcttgt

gtctatatgctcgatcgcggaatcggattttgaatgcatgtattatatcg

cattagcttagcaatgttatcgatcagtcgagtgtttatatcgctttatt

ctcagtcaacaacggtgctcgcttacattttatctaaaagagcattttag

atgtttagcgcttatctcaatgattgtgatcattaagaagttgaatgggc

gacagtgtttaatattttaccaacacactgtcccatttctttacagtaat

atttattcaccatttgaaaataaccgccatttatgtgtttgttattaatg

ctctaatacaccggtctgtatcgcttcagatatattcaaacctacctttt

attatggccgtttatgtttgttgaaatgttctttggtataatatattaat

gttttttttaatgatatggtcattaaaagtacctattccagtgtttgagg

tcgctgaattgagcagaatgaattagctgcgttagcttctggtttacgtt

atttatcttacgttacgtgtgcacgttatatactaacgttacattcatag

cacatacgttttatttaattattttacatatgctttcggtcttaatttaa

acgattaaaaaaactataaataatattgattagaaagttgtaatatgttt

gaactacactccttgctgtcagagacttcaatattttattattcaataaa

aactttaaaaaaggtttttattctgtgtcgttcagtttgtgtgtcatcta

aaaaacaaaataacttctgggtgtaaataatcctgatgtattttttttta

atgattgcacattgcaaaactgtactgatcgtgtatatatgcagttaaca

acattaaaaaaaattgctaattattttaggtgaatgctaggatgtcagta

tgtcttactccatctatatttgccaaacattactgtttgtatataaataa

aaagttaaatataagggggacgtatattgatttcaagtaatcttttgtgc

cccctactggattgattgtttaaaacaataataatattgaagtctgtgaa

aataaaatatacatttacaacttagttcatacacaattgtacatttggtg

atgaaaataaacaatattaaagtttatttttagctgaaaccaatgttttt

gtctattgtctatagtatcaattgatcatatactagttactaaacaggca

aaactaaatgaatacctgtcgctaatcacaaaacattatgttttaagaag

taaaaggaaccagttttctgtatttatgttctccatccgtgcctgatcct

atttaaattatgctccgttttaaccatagtgtattgttagcagccaaagg

ggattcatttaattaaccaaatgttttagcttgatttcggacacattttg

tcattgcccatttcacctgtattgacccaaagtgaaatgttttgttgtgc

tgttttaatatacaaaacacatgaatcgcaatcgcgtcatattaacggta

tacattataatagggattcacagtatatatttattagtaaaatgcgagtt

tgttattataatataatgcaacgtgtctcatattttatgtgtattttaaa

tgaaaatacaaattacaatgcatgcctaacacttcacaacatactcagtt

tgacacttgaatacaactatgaacgcaagtcaatctgtgtgctaatatct

tgtttgtgtgtgtgcgtgtctcagTGTGTTTGAGTGAAACTGTATCGGGT

GATGGAAGACCATACGGTGCATCAGACGGAGCATATGACCACTATCGAGG

CCCACGCCGTCTCTCAGCAGGTCGGGCAGGTGCACGTCGCCACATACACA

GAGCATGGCATGCTGAGCGCCGACGAGGATTCGCCCTCCTCGCCTGACGA

TGATGCTTATGATGACTCCGACATCCTCAATTCAACTGGAACAGATGAAG

TCACCGCACATCTGGCTGCTGctggtagatttctgcacatgctgcctctt

atgaaaatttacttgtttgagttagtctaatatatcatgcatcacagatt

ctgggttgaaaggctcaatca