NUP93 (dead eye)

cDNA: Genbank NM_130981

 

hi4, hi780, hi821b, hi2269, hi2400, hi2587, are in the first intron, before the ATG

 

hi1515 is in the second intron, the first post-ATG intron

 

tcatgatataatatcttggcgccaatagctagactgtacaatacccggta

taagatctacaataaactttctggatggacacatcactgtttggctccat

cactctctaaagctttatcatttcaaaattacattatgatcaagaattac

tgtaaaattttaaatagtgctacctcagcagccctttgtgctgggtacca

aaacttaacgcaaggactaattgttccaccatatctgcaacaaatgaatg

tttgtcattaccgacttttaaaaactgttatgaacacagatctctctttt

tttttttgtattcacaaaagcctggaatgagatcccacaacatctaaaac

aataactctaagacttttctaaagcctgtcatctgatggtcaactatcaa

tatagccactgagttagtagcctgctttcctctattttgtatgttttgtg

attgtttctactgttctcatgtgttgatggatgcgatggcaagtgtgtct

gtatgtttttatgttatgcagagcagcaacctgctgaaaaacagtattaa

tgctgagtcaggcctgattatcttttaatcttttcctgtttaaaacattt

taaataagatatataaatatatacattaaatttctttgaatactttccat

tgtagtcttattattgcttcttaacaaacaatatttttgtctctgataac

aaagttgtgtgtgtgtgtgtgttatatttttactattctatttaaattct

atattttatttaatattacaatacaacaatgctactagtgtcaattttat

aaatttctttattttctaagtttattgggtattggtcggtatctcagggt

ttcaagtaatacagaaattgtgtctgacatgatctttataaaggttcttg

tcgcgggggcttctgggaaaaaactgtttgaaccaatcagcgcgctcttt

caatggaacccgggagttcacgagggGGATGTGTTTAGCATAGCGGCTAA

AGCGAAATTATCCTATTGTAGCCACTAGAAGGATTAACAAACAGCGAGgt

gggttgttacatatttattaactaatcaactagttaatacctaataatta

tagttgcttttgacaggtgtgttttttgccgcgtttgccgacagcacctc

atgtcaacttagcttgctagccagtaactgagttctgctgagtgctgtgc

ttactaacttacattgtgctagtgttaatgtaaataaatcttaaacaagc

acacacatacacacacgcgcacacacacacacacacacacagagagagct

atattcatttattacgagtaatctactaatgactgcgttagtctaattct

cctgtg

hi4 (3-5)

tataatctct

hi2587 (5-3)

taatcatgtcactgacataccaaagttaacatgatagtga

hi2400 (3-5)

tatgt

hi780 (5-3)

gacataaaaacaagatccagttatttctttgcagtcataatccattaata

tgaaatttgtttggtttattagtctcactttcatttagactgttttaaga

gattgagataaagttgattttatatttcaccttaattcataacattaaca

ttatcagttaatataatagtactgttgtttttaagtcatactttcataca

atttaaaactgaatattcaaagtagcatgtcac

hi821b (5-3)

aatgtgtccttgt

hi2269 (3-5)

tcaaaaatgaactaatgtgcaatataaaaccaactttgccccagtctttg

agagttgtagtgagtgattataactaactggttttggttcatatcagcat

ttaatacagacactcaactcttgtgttcctagcagGTGGAACAGGTGCTG

GACATGGATACTGAGGGTTTTGGGGAGCTCTTGCAGCAGGCAGAACAGCT

TGCAGCAGAGACTGAGGCCGTGTCCGAGTTGCCCCATGTTGAGCGAAACC

TTCAGGAGATCCACGAGGCAGGGGAGCGTCTGCGTTCTCGTACTCTCACC

AGAACCTCTCAAGACACAGCTGACGTAAAAGCgtgagtcttcagtgtggc

atctgcgtataatctgaattgaggtaaagttggttttatattcgcacatt

cagactttctctttgataatataaatttagaaaattattatttgcaaatt

taaataaggaaattatattaacagccaatgactatcaaagtacaccattg

tttacagttttttttttttttgaagtcatattaactgcta

hi1515 (3-5)

tttcagacccaatattcaaattagtgttgtacacaatataggaaacgtta

aatgaacaaatgtgcgaatttaaaaccaactttaccttaatatacaccgg

catggctgaaaaggactggttaaccacaaaattaaaacatgatggcaatt

tagtcaccctcaagcaatccaagatgtatctgactttttattttaatttt

attttatgtttttaagaagttgaatattttagtaaacaccacggtggttg

cattcatttgttttgcctgtatgtgttagttttcacaacatacatcatga

tatttaggattaaatctgagagctccctcatacaatggtttcaagacaga

gtgtgtgcttgcttcagccctttgccaggaccatgg