flap structure specific endonuclease 1

cDNA: Genbank AY648844

 

hi4026 is in the 3rd exon

 

ccatggactttgaattaaagcactataaatctttgtcgccgaccaagatg

ctttcaacacttccgcatcagagaaatgctgcaaacctgtttcagatgct

tccacggactcctcagaatcgcttctttcgcttcaaaatccagtcagtaa

cacaggcgtatgtgtaatgtcatatctggacattgctagtgataaaacgt

gttctgatcttcgctttaacgcgataaaccagaagaaaggtcgcgatcaa

cagaagcggcgcacagcgaatccacgtcaccttaaaaaataaaaataccc

tttttaggatcttccggggtgggtgtggctacagcgcaacacctgcacct

gcttcgaaaagttcctgcatctagtatttccagcttgaaacgtaggctcg

acaataaaaaaacattttcaggcattttagaggtgataacaattaccagg

catttcctctgccttactgatgcttcgccagtcctgactaatcgatcgac

atgcacgctctgttgttattcctcgccaagactgaactagacaattttga

gatatcgagcccatcggtcgccacaagaatttgattggttatgcctgtat

ttagaattcgcgcgaaatagacgaagctttccgcgcggttgtagtcgtgt

cCAAGTGTGAAAGACTGAGAAGTGGATGCTGAAGCCCATATTTTATTagc

aagtaaaagttctgttattactacgttttgcagcttgttgagggttgtta

cgcaaatgctgctcgtgcacatgtcgattcataatactgttttgtggctt

taagctttatttagtttgaccgccgttttgccttgctgttttaaacccat

ccacattatatgagccacattgtgatcgtctttgtgtaaattcgctaatt

agcttagctttaataatttaacgtttattcttcataatcctttcagGTTT

CTGATAGTAACAGTTTATCACTATGGGAATTCACGGACTTGCAAAGCTCA

TTGCAGATCACGCGCCTTCGGCTATTAAGGAGCATGAAATCAAAAGCTAC

TTTGgtaagctctgcttaaactctgttgtatgtcgaggaagagcatgtca

gtgaatctcaaatacgacaagtggatgtttgtttgccctttatgtttatt

aaaggctttagttatgtcttgtagttgagtgatgagggcgtgtgtgttta

atagaaagagagtatggaagtatgtatttgtaatagtttttgtcagctaa

atttctatggtacttatccacatgtatttgtttatgtttggatggttgca

gGACGGAAGATTGCTATAGATGCCTC

hi4026 (5-3)

CATGTGCATCTACCAGTTTTTGATTGCGGTTCGACAGGACGGTAATGTGT

TGCAGAATGAAGATGGAGAGACCACTAGgtatatgaaattgttgtgacca

attcaaaacatgtattttgagtttttagccatttacataatacagctctt

ttgtcttctcagCCACCTCATGGGCATGTTCTACAGGACCATCCGAATGC

TGGAAAGCGGCATCAAGCCGGTTTATGTTTTTGATGGGAAGCCACCTCAG

CTCAAGTCAGGAGAGgtgcactatatgcacaaacatcattatccacctta

tttcccccaccactattatgctttccacaaattatgggagtaactttcat

taaagccaatgaaacatccaatgagtaacccagtataaacatccaagttt

aaacc