DEAH (Asp-Glu-Ala-His) box polypeptide 16

cDNA: Genbank BC045393

 

hi4049 is in the 5th intron

 

gacggcaggagatgcaacaatgtatcatttattacccttggtccggacca

aatgaagcgaactacagatgtgaaagcacccttaatctaccattttaggt

cattaatatgtaaagaataaagtacatccaggtggttattat

hi4049 (3-5)

cttaaaatctgaaacataattggtttgctgacatattcaggaattttaaa

tatctatttttttagtatttacaatgtcatttctgttgttaaaatgataa

gtaaatagcataattaaacttgactgttttcatctttgtccaaacattgc

agTCGATTCCTCAAAAAGACATGGATCTGGAGTTTGAGGAGACTCCCAGA

GAGGGCGGTGGAGAGCAGGGCCGATGGGAGGAGGCACGAGTGGCCACTGC

CACACTGCAGTTTGGGGCCAGACAAGAGCGCGAACGGCGGATCAAGGAGG

AGCAGGAGAGATACCAGCTCATTTTAGAGGAAGAGGAGATGATCACCTTC

GTCAGCACCGCAATTACCATGAAGGGAACGCTGTCAGAGAAGgttgacat

tatttatggttgtttttctgtaccactgcatcccaaatgg