nucleolar and coiled-body phosphoprotein 1

cDNA: Genbank BC048067

 

hi4050 is in the 1st intron

 

agatctctgatacaataaagctacattaatgaaacaatgaagtgtctaaa

atagcatgtttagcatgacgcacttattgtgcgccattttccgagcctcc

acgtgacgatgaaataacctatcgcgctcctcctccacGTGAGTGCAACG

AAGATGGCGCAGGACAGCACGGTTCCTAGCGATCTCTACCAACATGTGTA

CTCGTTTCTCGTGGAAAACAAGTTCGCCAAAGCTGCGAAGGAGTTTTTGA

GGCAGGCTAAAGTGgtaagagttgcttcagttgtttgtttggagtggtca

cgcgcgtggaggttgttaacgctcagctcggttttttttctgcacacgcg

tgggagcgacgcgcagttagtgcgggacacgtgtttacgagctgctgtag

attatgtgttaaataagatttcatttctgccggtcgttgtgtcattttaa

cctgtcataacacagctaagcgtttttgtacatgcaaccttttttttctt

tgtaaaaattgaatttgattcactgaagatgggcttcgggttctcaacag

gttcagtgttgtctggactgtatatactagagtaataaagtgatgtattg

gggtaaagttggtttttatattcgcacattcagaatatctcctcaatgat

ataatttcagaaaataatacttaacaaattctaagtagtcattggctcct

aatatgatttcccattgaaagtac

hi4050 (3-5)

agcattttcacagttaagtagtgcttgtgtttttttttattgtagaaaaa

acacgtgaaatttaacatgaaaataccctttttttatttttattttttta

cattttaactcttcccccctccctcccccaaagcatccacgttcagtata

gcaggtagatgtattggtatacatgggctaaggtaaagaaaaacatactg

tattccacaaataaaaatacacgtatgtcaatcaattaatcaatagtgtg

agaggtatttgcttgtgccattgtatagttatgttccaaaaattgtataa

acagatcccaaattttatggtactcctttaatttgccttttatactgtag

gttattctttccagtgcaatgtaatgtgtcaaatcttttagccagtgatc

aatcgatggactttctgtgttcttccaatagagtgctatcaaacaccttg

caataacaagacgcatatcaatcattttagttttataacctgataatgac

aaacctacaggaaataaacccaaagcgcatatattggttttaaaataatt

gatgaaattaatgttattacattttgccagaaattcttaatcaactcgca

ttcccagatacaatgaaagaatgttcctttatgtttttagcatttgaaat

gtatatctgggatgtttgggttaaacttgtttagtttttcaggtgtgata

taagtgcgcattgcccagttatattggatcattttaaatctagtataatt

gacaagttttgggctttaacacatatttgtctccattctaaatctgtcag

gtcaaattgtaaatctgtacaccaagaatctttcttagattctgatgttt

ctttagagccattgactaatttgctataaaacaaggaaatataatttgtc

ataggattctgataaaacattattttttcgcttgtgttgttttagtcata

cttgcatgctatttcagaccaaatattcagagtagcatggtaaacaatat

agagaccgtgtcacaagtgttcactcttcaaaaataaacgaaagtgcgaa

tataaaaccaactttacctcagctggagagtcattgtttttccatggttt

gatcatgatttatgaattgtaattgtttaaaccagggatgtccaaattcg

gtcctggagggtcgatgtcctgcatagtttagcttcaacttgcttcaaca

catctgactggaagtttgtagtaacttatttctagaaaaagagcttgatt

agctggttcaggtctgtttaattggggttagaactaaaatatgtaggaca

ttgtccttccaggacctagtttggacacctctggttcaataaaattgaac

aacagagctaatatgtaaaataagtgtagtaaattaatcaatgtgtcacc

acagagaagtctgcttcaaactcttttacattatgataatatttgaggtg

aagttggtttttatatccgcacattcatgctttcaaaaatcatattagca

gccaactactatcaaagttcaacaccgttcacagtcagttaaatggtgct

aacgttgatttgaagtcatgcttgcatgctattttagaccgaatagtatg

gtaaacaatgtgtcacaagttatcactgttaaaaataaacgaatgtgcaa

atataaaaccaacttaacctcagtttaataacacaatgtttacatttcat

gtattaaatctttaatatttaagttcttcaaatttttttttgatgcactc

aatataaattacaatcaactttttgttttcatcagAAACCTCAAGACCAA

AATGAGGACAGTCTTATGGACATCTTCAATTTCTGGGTCAAgtatgtata

tgttgtgtcttcattattactatgatctct