solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24, like (DKFZp586G0123-like)

cDNA: Genbank AY648845

 

hi4063b is in the 8th exon

 

tgcgaagaaacagcccactgtgagatgttgtgacattgtgagatatttaa

acaatgtaacaattgtattttatgagaaactatggttgcatttagtaata

aaaccaattcatacattccttttttccttcacattattgtaataattaca

acagtaatgaaatgttgtagtcagcttttaaaatgttgttattacaacag

acccaattcagtttatgtgggtttactgtatattgacatctaagttgatg

gacttattcttttaatggcagGTGCTAAAAGTTAGACTCAATCTCCAACC

TGCTGGAACCTACAGTG

hi4063b (3-5)

GAGTTTTGGGATGTGCCAAGTTGATTTACCAGAACGAGTCTGTGACGGCT

TTTTATAGAGGCTTCAAACCCAGCATACTCTGCATGATTCCATATGCTGG

AGTGGAATGTGCAGTGCATCAAgtaagatctgagtattccatcaacacac

aagccataaaactgttctctttcatacattagcatgacagagaccctaag

ggctttctaaatgtaaatgatcaaagttctcttacatttgcaaattaatg

taaataaaccatggtaaatgcagatagaacctcattctgaaaagtaattt

tccacttggaattataaggttctatctggcagattattcattgaagcatt

acttatcaagaaatataataaataaataaataaatagtttagtgttgtaa

caatatgttgatgcttgagaaagtaaaaatttagctttctgtaacattta

tttaatgttttaggataaatattttttcttttaaaattaagcatgcaagg

ctgtgctaaatatttttccagtgcagctgttaattttatctaattaatat

gtttatatttataaaaaatttcacgctttaaataaattattgaattatat

ttattgaattatatgccccatgaaataaattaataatttgcccttcaagg

cctcattttaaacttatagactttaatgacaatgagcaaatgagtttaat

aaacactgtaaagtgtttcactacacaaataaaaagatttcacatattta

atatacaaatttttaaatattaatttctttttcaacaatctaaaactgag

catttcttctcaatgtttgcgatgcggtggcgcagtgggtagcacaattg

cctcacagcaagaaggttgctggttcga