intraflagellar transport 81 homolog

cDNA: Genbank AY618922

 

hi409 is in the 1st exon

 

agttaattatatagtgtatagattccctatatcataatatattattaatt

tttttaaacatcttacgttactgattattgtttagtttcaaaaagagtta

aaagtcttttatggggacttttactttaaaaagtaggaaatctcttcaca

ttgtccaacttcctgctagcaaccgggccttgtgtGACAACGGTTTCTAG

GCAGGATTTGTTGACGTGAGAGGGAACGTTATACGACGTTATTATACAAA

AATTTATTATCGTTTTCATTCATCTAAAATCAAATATTAAACGACATTCT

GTGCTTGCGCTACAAAAGCTATAATACGGTAAATAATTCGGCTGTTAGCT

GCTAACGTGAGTTGGAAAAGTTATTTTGAACACATCGCAAGCTAACGGAA

GTTAACGTTGTGAGAATATTTTTGTTAGCGGTAAAAGCCACTAACGTAAT

TCTTCAAGATGAGCGAACAGCTTAAATTTATCGTTGAACAGCTGAACAAG

GAGCCTTTCAAGAAAAACTTCAATCTCATTACATTC

hi409 (5-3)

GACTCTCTGGAGCCAATGCAGCTTCTGCAGACTTTAAGTGATGTTCTGGC

TGAAATTGATCCAAAGgtaagttgaagatcaaatttaatatgactaataa

aaccacaacctatagcaatacatatctataatagtacatagtatcaaaac

ggtaaataaaagtagggcttcacgttattttatttttctgcagtttcaga

agatggtttaaatagctttatttgattgtttttttctatgcagtctaaca

gtattcgggtaacagaaattaaataatcacaatggaaaaaaatgcatttc

ttaacttgctttgttttgtctcgtttttagttacaaatatacaaacaatt

tctaagactaagtaaagatgctggttagttttaatcgtccaaataaagga

aaaaattaaaaaaaattggtttaagaggtttatcttttgttttaagggga

ataatcttgttttcactttaaatgtggatatttggactggaaacaagaca

aaaattctaagaaagaatggttggggttcataaatcatttatattccata

taaatacagtaattaaatacaatttattaaccatatcaacctgcagccca

agaccggttactcactgaagctaagcaggtctgagcctggttagtacctg

gatgggagacgactagggaacactaggttgctgttggaagtggtgttggt

gaggccagcagggggcgctcaacctgtggtctgcgtgagtcctaatgccc

cagtaaaagtgaagaggacactatgctgtcactgggcgccgtctttcgga

tgagacgttaaactgaggtcctgactctctgtggtcattaaaaatcccat

ggcacttctcgtgaaagagcaggggtgtaaccccggtgtcctggccaaagtc

cctctatcggcccttatgatcatggcctcccaatcatccccttcaaccga

attggctctatcactgtctcttcactccaccaatagctggtgtgtggtaa

gtgcactggcgctgttgtcctgtagctgctgtcgcatcatccaagtggat

gctgcacactggtggtggtgtggagagaccccccccccatgattgtgaag

cgctttgggtgtatggccatacacaataaatgcgctatataaatacacat

tacattacattacatttacattacaattctttagctcctggttaactata

atttagactcaacattgaatatcctgcgatgtggctattgcgaatgcgca

cattgcaatatcgatgctgaaactatatgttgtgcagccctaatgtaaag

gatagttcacaccatactgaaaacttcatttacatcatttactttatttg

ttccaagctggtttgactttcttctgttgaaccactgacttgcatagtat

ttgtttatcccaactttagaagtcaatagtcacaatttttaagttttctg

caaaatatctactttaatatttaacagaataaagaattacaaaaagtttc

aaaacctcttgaagatgagtaaatagtgagcaatttttcatttttgggtg

aacaaggcctttaatattctttcacagtttcctttgaaaccacattttat

ttttagagagtactgtatagatctttatttatgtaatgtgttcacactga

tagtttttgacactttttcttttttctgaatcttttttcagCAAGCCATT

GATATACGTGAGGAATTGCCTGAGCAGACAGCCAAGAGAATGTTCACTCT

TCTGGGAATGCTGAAATACAAACCTTCTGGAGGAATGTCTGAAGTgt