methionine-tRNA synthetase

cDNA: Genbank AY648846

 

hi4134 is in the 1st intron

 

agatcttattcctgccctgtttttacctgacactttgagacagaattaca

tacacatatgattatttttacttacgtgataaagctgcagatggacggat

cgtaagagtattaacgctaaagttagccttcaggctagctgaacttacct

tcataattgcacaggtaggaagatgcatacaacttgaaacccttctcaag

ctttgctctgcggtgttgtagagcacatccggacaatcatttgcacatcg

ttgaccataatttactcgcaaacagcgagtaaatattgacgactctgcca

taatactgtttacctccgcttaaaatcacccagaccggaagctggaccgc

ggccttagacaaaacgcggaagtaatgcgtgcatatagcccattCTACGC

ATTTCCCGAGAGCAGATGACATCTAAAAACTACAGTTTCTCTGTACGGCT

GCACGTGGTGTGACGCTCGGTTGCATCAGCGGCAATAGTTGATCGCTTCA

GACCGGTTCTGCTCGCTGTTGTCGGTATAAACGGCGTGTCGGTCTGACTT

TAGGAGCATAATCGCGGACGGTGAAATGAAGCTGTTTATCGGTGAGGGAA

ACCCGCACTGCCTGAAGGTGTTGGCGGCGCTGGAGCTCAGCGGAGTCCGG

TGTGAAACTCAGCTTGTGAAACACGAGGgtgagtgtggaggaaagtgtgt

gtgtgtgtgccgtgtgggattgtgaagtgttgtgaatgttttgttgtggt

gcttttggttgaagtatatttagtttttgttttgtcgatactgtttggca

attttcagactttgaagacattgaggtaaagtttaccggtcattttaacg

gttcctataacgttacgataactacaattatcgatctgaaatcccactca

aacccatagctaataataaatcacaagaaataaagtattgtcaagtgtct

cttcgttatttccacagctgtacacacatgataatactttaggttttcag

taagaattaaactaatgtcaataaacagtgaaacagctgtttaacttagc

ctttaaatgtcataggtagatagatggatagatagatggatagatagata

gatagatagata

hi4134 (3-5)

gatagatagatagatagatagatagatagatggatagacaaagatagata

gacaaagatacacagatatattgatgtataacgttagatagatagataga

tagatagatagataatagaggtaaagttggttttatattgggatattaag

acattctccttaataatataatttcagaaaagtattctttgcaaattata

aatagcgaaataatattagcagccaatgactattagagtacaacattgtt

tacagtgaattagacagtgtaatgttgattagaagtcatactagcatgct

tattccgattgaatattcaaagtaacatggcaaacaatatagagactgct

aaatgaacaaatgtgcgaatataaaaccaaatttacctctatgaatagat

agaaagatagatagatagatagatagatagatagatagatgtaaagtgca

tttatattttcacattcgttcatatttgaaaagtaacaacttgtgacatg

atcctatattgtttacgttgaatattggctctaaaatcccaagactttaa

aacaacttatttaattgaacgtaaataatgttgtattttgatagtctttg

gctgataatgtgacttccctgtttataattagcaaatagtacttttctta

aattatattaaagagaaagtctgaatgttatgaatgcaaatgttgtcttg

aagctatacttgcatgttatttcagaccaaatattcaaagtagaatggta

aacaatatagggactgtgttaaaagttgtcgcttttcaaaaatgaacaaa

cgtgggattataaagcctactttacatctgtctgtctatctaaaaactct

ctttctggaggtaaaaaatacagtcaggggctaaacggctgtttcacttt

ttataagttgttttctgactgaaaatgtaaaaatattacgaagagtacag

ctgtggaaataatgaagacgcacttgaaaatttgcagtatctctgtattt

attgttagctaatcttagtggagtgaaatgttaatatttgttctatttac

catattatcatttttagttttaatttttctttcattccaaaatgactgat

agtcagatgaacaaatgtgttcacttttcagtttgtctggatttattatt

agaaattaaaatggttaatatatgtttatttaaatttttgttttatttaa

aatataatccattcatttaaaagatttagttttctttttaaaataattgt

tggttagagtaacaaatgtttttattttctatgatggaaaatcagggcaa

tattacagcaaatatcggtttattagtattgtgttttacaaacattatca

taaatatgtctgaaaacatgccactataactattgctgaataaatgtaat

tttactagattaaagattaaagcaaaaactattatttacaaaactgaaaa

gttttatatgtgcattaaaggaatagttcacactaaaatgaaaatgcttc

taaacttttatgaatttcctttatgaaaacatgaagaatgttttgagttt

aattatgcaaatgcagcagaaaatactattgaagtcaatgcctgtttttt

tcagcattcttcagaatatcttcctctgtgtttaacagattaaaaaaacc

caaacaggtttaaaataagtggaggatgaggaaattttcttctgaatttc

catttttgtgtgaactgtcccctttaatagcctgtttggtatagctatga

aagttccattgtcttactgtggagttgttccagtgctttgcgagtgtgtt

tttgtccaacatgaatgtgtctcatgtgtgtgtgtttgtgtgctatagAG

AAaGTGGTCCCGTATCTCACACACCCCGTGTTGCCCATCCTGCAGTTACC

CAGCGGTCAGCATCTCTTCAGCCCCAACAGCATCTGCCAgtgagtgccgg

acattcacgcacacatttagtgtaacaacactt