signal recognition particle 68

cDNA: Genbank  AY648847

 

hi4153 is in the 1st intron

 

acttgatcctagtaggtggcagtatatgcaactaaagctggtttgacaac

cgccatgaaatcaaagaagaagacagaggacctatcttttactagctggt

tcatcggacgtgtacttgctgaaaaaATGGCTGCAGAGCAGAATGGAGTA

AAAATGCCGTCAACTGAGGAAAATAAAGAGAACAGCATCGATCAGAGTAT

TGGTCTGGAGAgtatccttaaagctaaatctaacttacagtatcatttat

tttttagtggtggagacaatcattatttcaacagttaaaaggaggacggc

tgctacttggtttttatggaatacgtgtcagttgatctaaacaattacag

attggaatatcgctttttatataatatccattataaataaatattataaa

tgtatgtttttttaataaatggagtaattagcggtaatag

approx hi4153 (3-5)

gtaattactgcattgagccctcctcagactagtttttgtgattttatttt

ttaattgcggttgtgttttgtggaagggattgtatatccaaacatgctgt

tagctattttaaaggtctgggtttttttacttaaaattgactacagTTCT

GCAGATTATTAAAGACTCTCAGCAGCAGCATGGACTCAGGCATGGAGATT

ACCAGCGCTATAGgtaagactgtgggagatatttcttttttgttaagtta

tattataacacaaatacaactacgttaatattttcttctttcctctaagg

ggttattgctccagACGGCTGCGTCGTTTGAGAAAGGCTCTGGGCTTTAA

AATGGGAAACAGACACAAGTTTACTGGGAAAAAAGTGACCGTGGAGATGC

TTTCAGACAACCGgtaacttttagcagtttaaatgaaatattaatacgat

gcattattttttttaatcttagtcattttgtatctgtctctctttcactg

tactagATATCTGTTGTTAGTGTTAATGGAAGCAGAAAGAGCTTGGAGTT

ATGCTATGCAGCTAAAACAGGAAGCTAACACTGAGCCCAGAAAGCGTTTC

CATTTGCTGGGTCGCTTGCGGAAGGCTGCCAAACATGGAGACCAGCTGGA

GAAGCTGTGTGAAAGTCCTAATGTGGATGCTAAGACCAAACTTGAGGCTC

AGgtaagtcaaagttcttttttatgattatttacatatatgattttagta

agtaccacaaaatatttacttgagtaattaaactttgtccattgatttaa

taaaaaagctaattttaatactaagcaggggtgtgtgatacagcctgatg

atatttttcattgttttccaaggctgcatttactctgcaaggttcaagtg

acccaatttagatttttgtttcttaaattgaacagatcggatgtggccct

tgtatgtgtaagcaggggaaaaaatccaattcagatcagattcaggcctc

gttaatatgtggaaatatatcctgcccttgtgcctgcagcattggcacat

agatcagattttcacccgtcaatgtgattaaaaaatgctagtgaataatg

ttaacacagaaaattattatgaaatgtgatttcttcagtgggaatacaat

gattataaatctggggaaaaatatgcaggacagtagttatgcctacctgc

aaaaccttaatagcatcaaaggattcacattggagttttggtgcaaacag

gagaggtgcatatttaattctgcagtgagttgtgcagctgtggttttatg

tttttttggcttagcacccagacatcccctttcagactaatttctcttgc

atccacagttactcctgttggatgtggttcatccttcttggtggtatgct

gacattacactggatatactgtggctttgatagatct