GLE1 RNA export mediator-like

cDNA: Genbank AY648848

 

hi4161a is in the 1st exon

 

tcgaaacggaagtcatttttaagcaccggctgctgcggcttgtttgggct

gctaaaggtgtttctagtttatatcaaaagttagtgagggattaaaacat

tttaatgccctcaaaATGCCTTCTGAAAACCTTCGGTGGGAAACGTTAG

hi4161a (5-3)

AAGCGCTGAAAAACTCTCCGAAGGGGAAACTCAAATACAGCCCAGACTGG

GTGGAAAAAGGGGAGgtaaaatcgctaacgtttctattttgacttttacg

ttataatggtttaatcgttgctattaataacaaaacaatgttgttt