polycystic kidney disease 2

cDNA: Genbank AY618926

 

hi4166 is in the 1st intron

 

agatctagttgcctggtagcaacagtcacaaacagcgttaaagcgagtgt

tgtgaatgcaagtagttctaaatataagtttagagtcacaattttaggat

aatttttataaattattgtccattactttaaaaacgattttaactactta

ataatcacgtgttaatataatgtaaaccattattttttttattttatgaa

ttttatttttcattaaaaagcatttttgtgagtgtcagtgagcgtgtgtg

taggacagaaagggaggagctgctctaaaaagggaaatgttgaagtttcc

agaggttgatgtcagtgtaactggattcctccAGTCTGGAAACAACTGGG

AACAAGATGGCTGAGTTTGGACTGGAAATGAGTTTTTCTCCACTCGCACC

AAAAGCTGGACTGAAACCTCTCGAAATGATTTTCAAGTAAAGCCTGCAAG

TATAAAGCTTTCTTAAGGTAACGTACTCGGGTGCGTTTTTTTAGACAAAA

AAGCATCCAGCGGTTTGTGTTTAGTTTCCTCAATCGCGTTTTCTCGCTAT

TTCTATTGCATAACACCTTAAAAGTCGATTTAGTGCTTTTTTAAACATCT

GAAAACCCCGTTAGACTTAACAGAAATCAACTTCAAAACTTTCTTAACTC

AAATAAAGAATCGCTTTGCGCATTTTCGCATTAAGACAGAGTAAAAAGTG

ACTAAAATGCAGTCGTTTGTTTATATTAATGTAATGTTACTGTAGAAATA

CACGATGAGCTCCAGTCGCGTTCGTCCTCAAGCGCCGCAGAGCCCGGCGG

CATCTGCATCCGCATCTCCTCCACCGCATGAAGGCATCGAGATGGAAAAA

ATGCATCATGAAGAAGTGGGCCTCGGAGTGCCCGATGAGACCCCCTCCTC

TCCGCCAACCTCCAGCTCCAGACAGGCATGGAGCCGGGACAATCCTGGGT

TCGAGCCGGAGGAGGGGATGATGGAGGCGGACTGGCCCCCGGAGAGTCAG

GGCCGGAGGTCTGTGTCCACGACGTCCAGCAGCAGCAGCGGCGGCGTCCC

AGGGAACTTCTCCGGTATCAGTGCGCGGATCAACAGAGGACTTTACCCGA

CTCCTCCAGCACAAGAGCACCGCAGCTGTGGGAAGAGGATACTGGAGAAA

ATGAGAGgtcaaacttttgcttgtattgttttattgaagtgcta

hi4166 (5-3)

ctaaccattgttaccagtatttaaagggatagttcaccgaaaatgaaaat

tctgttagcattaactcacccaatacttgtttcaaacctgtaggagtttc

tttcctctgttaaacaaaatagaagatattctgaaaaaatgctgaaaacc

actgccatagtattttttatactatgtttgtaatcacaagttatgagctt

taaaatagtgttcaacaactatgacaactgaaaaaaaactgcattggaag

tcaatggttacaggtttttaggatttttttaaaattaatacaggtttgaa

agtacttgagcgtaagtaaatagtgagtaaattcttgtattttgggtgaa

ctatatctttaattccttaaacaactagctttgaaagataatttgtggta

agtttaaaatgcaaacaataaatcactttacaaatgaagtttactacagt

atatactaaaacatgtaagctatacttgcttctaatagatagccttctca

taaatcacactaaatttaccaaaacaagatggtaaagatttttagattgt

ttttaaaaagtttttttttcatatttgtaaccatcaatatcaaacacttt

gatactgtaaacaagcacttttcataaaattgggataaatttatttctta

ttcaattgatcaaaggatatattcaagacttttgcattcttaataaaccc

aattcttttacaaatagttttttgttctaatcaagagccttcacgtgaaa

aaatcaagtagccttgcacaccgggatttcaaccctagtaaatcagaacc

agcatttggatttctgaaggtgtaacactgaagaatatttaataagattt

aggtctgggcaaaaaagatttcaattaatgaataataaaaaactgttgat

tcagtatactgtctctaaagcagtttatgtacatttgaatatagaccatt

tcaatgaggtgatggcattggttcatgaacatttactgcctgttattaaa

ctatttattaactgtaataagaggcaatttaatcataacttattattaaa

acagctatcatagcataactatcataacagctctttttggattctcggaa

gctatagaaattaaaaatgtataacagcaaatacgttgggactattgttt

ttgttcacatccctcaaaatggtctaagcatatttcatattttaaatatt

gattattcattgcatgcatctgaactaaatatttttaaaataaatttgtt

taaatgtacccatgtctaacttgtattgtagattgtatcctacagatgtc

agaaactaaatttatttttgttaatttaccattagcctgcacattcaatc

tgtaaaagatatattttaaaggcattagaaaatctgataaaccataaaca

tttaaagttagagtgtgattttttttatatagtcactgataaaaaattga

caattttaactgacatctaatttctctatttcagTGTTGTGGGATACTCG

TCTTTTGGGTGAGAGCAACAGTAACAGAGAGATGTACTTGAAAACCGTCC

TGCGAGAAATGATCACCTACATCCTCTTCCTGCTCACCCTCTGCATAAgt

aggttgaaaactacatgatagagtgataccaggctcaaattacacaacaa

cagcttcacgatttctttatgatagtgtcattaaagtgtcatt