cdc39-like

cDNA: Genbank AY648849

 

hi4201B is in the 1st intron, before the ATG

 

cacttcatatgttgcgtagtcgcgagctcgtgcgcgagctcaataagcac

cgcactgggtgcgcgcgcgtgccgtgacaatccccattttattttGAAAA

ATCCAACCGAACCGATGGGAGAAGCGACCTTTTATCCGTCAAGATCAGAA

CGAAGAAACACGACGAAAATGATCATCCGCACGTAATTTTTCCAGGATCG

AGgtaacgcgtccactctctgcgctcggcgctgcgctataatcccccaaa

gcgctggggatataaattggttatcatatgttgtctgctcggctaattta

acgttagcttgttagcgtgtatcttaccttgcttgtttaacggctcaaaa

actcctaagaagcaaatttgccctacgcgcgggatggtggaaatatctgt

aacggcctgtaggagttcggttggtgatatgaatcacattaattgtggag

agccttctagtcatgaccagggctcgtgttggtgctacatgatcactggt

gtgatttagactccgagtttggtttctccaaccacataaatgtgttgagt

gaggcccagtaaacagcagtatggctatatgctaaactgcatggctgcta

atgttcactaacactgctttacacaaacttccatgtttactatcatgtag

tacaccactaacgttaccagtgcatttattacgcctttacatgagtcagg

ctgccagatattcttactagaagtg

hi4201B (3-5)

gaagtgtgtgccagtgttttactaacacttgacttgcatgagatcatcat

gggttgaagatgcataagaaccatttttgtgtatttctaacgttaatgtc

ctaaacaaaccagacgccaggttcctgtcagttaggtgagcatgtcggga

acaggctaagtgctcgtcaccgtttgaaacaatgaggtttacgctgttag

cttagcctagctgttagcatgctctggattagcacgactgttactgaatc

tgacagaaattgtggtttaaaatgccgagagagtttgttttgagatgatt

agagccattggctgataaacgcatttagattgtgtgttttagggcacaac

tgtgtacattttaaatgtgtaaacaaaaagtttggtttaagatgagttag

cactaggattgctaacggtgttttccacagtcga

 

do not know how far to next (1st coding) exon