intersex-like

cDNA: Genbank AF506210

 

hi428 is in the 2nd exon

 

tagtgcgcaaacagatttgaacgcggtgagtctattgacaccgtataata

cgttcatatccgttgcagactagcatctagcggaagtggacgagtttatt

ATTCATATCAGCAATGGCGTCCCAGCAGATGAGCACTAACAATGCTCAGA

TGAGCGCTCAGCAAGCGGCAGTTTTACAGCAAACACAAGCTCAACAGCTC

AGTCAACAGCAAGATTTCGACCCCGTTCACAGATTCAAGATGCTAATTCC

ACCGCTCAAAGACAGTCTACAGgttcatttggtgcattctgttataagca

taatatgacctggtctgttataagtacagtactaacgtttatttgcaatg

tttggttttcagAATGTCATGACCATCGCGTCT

hi428 (3-5)

CTAAATTTTGCACATAATACTGCTATTGACAACGGCTTAAAAACAACCGA

gtaagtgtttcttttcatctttcattgtagttaacatttcctgatcttgt

gtgaagtatacagtatggtatatgaatatgtggaccaaagacgatatggt

ttctggatgaaatcatattttgtgaaataaagggatagttcacccaaaac

cgaaagttctgtcactatctactcatgcttcacttggtccaaacctg