digestive-organ expansion factor (DJ434O14.5-like)

cDNA: Genbank AF506211

 

hi429 is in the 2nd intron

 

ctcactttgccccccttttttctgcatctttaccataattatgccaagcc

ttaaggtggcgctagagtatggtattaactatccatgaagaaaagaaaac

AGGAGCTGGTTACACACGTGTGTGTAGATGTAGAACAGAAACATGGGCAA

AAGAAGGCGAGGAAAACAGGAGATTGATAATTTAACTAAGAAACAGAAGA

AACATCTAAAGGAATTTGGTGAACAACACCCTTTTCACGATAAgtaagta

ccgtgatgcgttgttcaggacacagctcgcagtataagttaagttagcat

acattcggagctttacgtgtaaaatatgaatgcttttttattttagGGTT

GTTGAAAGACCGGAGAAGACTCAGATTTTGCGCTTGgtaagtcattatat

tcatgtattctttcatcagtcaagtgaccaattattttaggttcaaaaac

ctgtaacgttatatgaatgcatttagcagctggatctgaatgacatacga

ataaaacaggagtcgacatttgaagtggagcaaaacctttcatcaaagtt

gcacaaaaactattgaatgtattcattagatacattcataattcattatt

gccttacgacagtttttttaattgattcactttaattgtcgactgctata

cagtgtaattgtgaaaacatttgctagatcacctaagggaagctgctgct

tttgaggtgaagttggttttgtattcgttaattttaacgctctctctctc

tcttttgtttaccacgctaatttgaacatttggtctggaatcggatttaa

gcatgacttca

hi429 (5-3)

aaacaacattgcctctattctattgactgtaaacaatgttgtattttgat

agtcgttggctatagtacgattttcatgtttcgaaatagcaaattgtact

tttctgaaatgatattatggagaatgtgcaaatattaaaccaactttaca

tcagtgctacagctggtttaatgtcaaagtggtcttgaactgcatctact

attgttttgctaacacactaaggttgttgagttaatgtatttccgaatcc

taagataagcaaagaatgtacaacaaatgtgttatcgtatttattcatct

ttgttaacgttaattaattaaaatacagtttgttctttgttagtttgtgt

aacttcacaatgcattaactaatgttaacaagtacaaattcaggttttgt

gataaaatatgaataataaatgctgtaccagtattgttctctatgagttt

gttaacagtaattattgaaaccttattgtaaagtgtgagcattattttat

agtgttgtgagatgatgtagaggaagtctgtcatcgcaatattgtttcac

actgagaccatatgaaaatagctctttattgatttcaaaaccaggtggtt

tcaggtttttgtagaacactataactctaatgtcaaacgcttgagggaaa

ttagaattttcagttcataaatcctggtttgtgttcattaatggctcatt

atcatgttctgttgtgtgtatgaagaaaatgttatgtttccaaccatcac

actaaaagaagttctgcccccaaacagCCTGACAGTCCACAGCGCCCTGA

ACCAGACAGTGAGGATGACAGTGATGCTGAGCAACCATCTGCATATCAGA

AACTACTGTCCACCATGATTCAAGGTGATGAAGATGATGTTGAGAGTGAA

GATGAAGAAAGCGAGGAAGAGGATAACGAGGAGGAAGCTGAAGgtaagat

cttttacacttagcaaatttcattttcatttgaaagggtctaatggcatt

gacttattatatcttatctattttttattaagttgaaggtga