hi43 gene

cDNA: Genbank AY648709

 

hi43 is in the first intron

 

atgcatagtctgtaattctaacctgaaaacaacagcacatttatttttag

aatgcaattttgtagaaagattttggacaggaatatattggcttgtcttc

tcagcctacaaaacctttttgattttaagacaattaattaatttattgtt

tttgatgtgggagttagattgtaaagaaatggaaaatatgttaaaaaata

tttaactctttgtgttacatctgcacaaatgtagttattcagtgtttgcc

taattttagaacattttgtattgacttgaaactttattatgaatctgtct

gcctatcgcaaaataagaaagctgctaaaacaactgaactgcaaaaaaaa

aaaataataataataatattagcatcatgatcattacctttaagttatca

gatctcttttggtacgcttgtgtaacattcctaataatccaaatatagtt

tgagatatatttatatatataaatatatttttttctttgaatatttgttt

ttctttgtattgtttttttcttataccttgaacgttatcatttttgttac

tagatttacaattattatgtataaattgtattcaggtcacacaatgttag

cacaaattaatgttttatgtattccctgttactgtattatattctgtaca

gggcaccacctagtggtgtaatttagaatacatcacagttacttatgtta

ataataataataataataaaataataataataataataataaaagtcctt

cttcttccactgcgcatgcgcgttaaaccttTCAACTGATGTATTTCCTG

GGCGGAACCACATGGCGGCCTCCATATCAAAACAGAGCTGTGCTACACGA

GGATATTTTTGTCAAGGCAGAGTAAGCAAGTGACACTGAACATCATGCGA

TTGTCGCTTGCTAGGAGTACCTGATAAGTGTAAAGTCAACTGTCGTAGAT

TAAACATATAGATATGGATCTCCGTAGCAAAGGCGACACGTCGGTTGGAG

AGGTGATGGAGGCTGACCCACGCGCGGAACTGATCTTCGAGACCCCGCCG

CCTGATGTTGTCAGCTCCATCAACGCCCGCTTTGAGGAGATCGACAGCGC

CCTGAAGATAAGAAGAGACCCGTCTGTGCACAGTCCTCCTTCAGACAGgt

hi43 (5-3)

aagaaaagatttgtagctactagttaatggtattcgtaaatgtttgcagg

gctcccatgtgttatggaaattctggaatattttgtcatttaaattgaag

caaagttagttgtatatccacaatttcactaattttgacttgctcaacct

taataatatcattaaagtattctatgcaaattctaaatgttgatattagt

aaaatacaaccaaagagcaacatatactcaaatagtgcttatgttatatt

catatattaacatgtgatttcagttcaaatattcaaggtaccatggtaac

ccacatagcaaaatctctctggcccagctctggcccacacaatcaggttt

tgcttggcccacatgccgcagtgaattacggtacatgactggaccaaatc

tggcttccagacaagggccaaacacagaccatatctgggccaagtctcag

ccaagttaataactcataactgggcctgaactgggccagataggttggtg

tgtcacgattgcaatgaaattgataaacccatggagtgatgcgctttagg

cacactatgggcacgctttttctcaaagtgacctgattggtagaattttt

tttctttactcaaaaatgattttagtgtattttaaatgtgggtcaagact

ggccaaactcacatggcccacttatcaaatttttaaatctgggccaaata

ctacgttttacatctggcccaaatcttgtgtgccaccttaaaaacggtgc

cacctctgccaaacccgggccatgtttggcccacatgctgtatgccagtg

ccggatgtatgcctgctgtgccagctttatgccaaatctgggccagaatt

ctttgctactagggaaaaaatatacagagctggtcacaagttgtcataaa

atgaatttgcgattataaaaccaactttacctcattcgttcatttttttt

tttggccaaagtccctttattaatcagggattgccacagcggaatgaacc

gcaaacttatccagcatatgttttacgcacgtacgctgcggacaatttag

cttacccaattctcctatagcgcatttctttggacctgtgggggaaaccg

aagcacccagaggaaacccacgcgaacacagggagaacatgcaaactcca

cacagtatgccaactgacccagccgaggctcgaaccagcgaccttcttgc

tgtgatgcgacagcgatacccactgcgccacaccacgccaccttcaactt

tacctcaattcatttttaaaattgtatattccagtcattataagtcaggg

aattttatgttttataaatggttcccgcttgtaaaattaggccttgaagt

atttactaacgattttattttttaattgtgtgaatgtgtgtgtgaatgcg

agagtgtatgggtgtttcccagtactgggttgcagctggaaaggcatccg

ctgtgtaaagaatatgccagaatagttggtggttcaatgcgctgtggcaa

cccctgataaataagggactaagccaaaggaaaatgaatgaatgaatgaa

tgttatgtttgtaatataatatacgcatgttttctcaagtactgtatctt

ctgcattctcctgtacagTGACTCTGAAAGCCTGTTTATAACACAGTCTG

TGACGAAAGTAGTTCACACTAAAAGACGACTCCGATCATCTAAGAAACCA

GACTCCATCTCTGATGACTCCGGGTATGTGAGAGAAAGGAGACTCTCGGA

GAACCAACAGACTGAATGTGAGGAGGAAAGCAGAAGTCTACGTTCTTCAC

GCCGCAAAAGATCAAAATGGGAAATGTATGCCTCCGCTCGCAAAGCTACG

TTTCCCTTTTTGATGAAATCACTCAAAACACAACATCTGCCTATTAGGAA

GCACCAGATTCTGGAGgtggggttttgttcatgtgctgtttatgcatgtc

attttataatttatttatttatttataatatattatgatattactgttta

aagagctcttattatgcattaaaaggggtcatattttggtttatttttac

ctaattatcccaacgactcccatattattcgttcagcgatttcatttgtt

cccaaacccctcctttagcgtgtaaacaacaacagaggaaacactgagaa

ggaaagtggtcagtcgccacaatttgctcccaccagacctgagatctcac

tcatacccacaaattcctctgaatggtggaggacaccatatataaacaat

agtcgcaagctgcgatgacgaccctttcccctcctcctccaccccaaaat

ggttataaagttgggtgaagtttgcatatttcgcagagctaaaaacaaga

caatttcttccatcgtggcttgtgtggcgcagatgtttaaacccacattt

acgcatagacaacactgtaaagtgtatggcaaatgtaaacacgaatcaga

tatgggtcacaattaaaagaatatgtaaatggacaggcaaacaaaaatca

attatagacagcaaatcggagttgggcatcaagagctgacagtgtaaacg

gggcctttgtgttcgctatgaaagaaaaaacctatcaaatgtttgtcgta

gtcatga