ADP-ribosylation factor-like 13b

cDNA: Genbank AF506213

 

hi459 is in the 5' UTR

 

gcaaccctgaccctcaacgtaatagcggctgcagccatagcagccagatt

cagcttggtAAACAAAGCGGATTGCTAGCGAGCTAACAGTTAACGTTACC

CCAGTAGTATCTGTGCACACAGGGGCATAAAATTAAGAGTGCGATTAGGG

GATGTTTTAAAAACCGTGCGCACAGTCAGGGTTTAATTAGATG

hi459 (3-5)

TTTCTTTCTGCATTATGTGCAATTTTATAGTTTTAATGCATCGTATGTAA

TAGCTAACTGGTTAGCCCTCAGTGAGACAGCTTTGATTCGGGGGAGCAAA

ATGAAACTAAACTATAATGGTCCGCGTTGTAAGTGATAGTTCAATAATTA

AGCGACGTGACGTTATCTTAGCTGACCAGCTTTGTTTTATTTTGACGTTA

TTATCATGTAATAACCAAACAAAATGAATGTACACATCTTTACGAGTCAC

TCAGATAGTCAAATAATAGCGTGTTAGTAGATAACGGGTTGATTAAACAT

ACAAAGAGGAGGCGTTAAGTGCTAACGTTAGTAATCAGCTAACTTAAAAC

GACTGTCATGAAAAAATAAACCCCAGTGAAAGCATTTAGGGGGGAAATGT

TCAATCTGATGGCGAACTGTTGCAACTGGTTGAAACGATGGAGAGAACCT

GCAAGgtgagtttcttacaactcttcgttcttttttttgtctcagagtca

gagacacagtaagatatgtcctttttcccaaagcagacttgtcattgaaa

tgaactgtaacttaatgtcatatttgtacagtgggtctagtaacgttcac

gttacatatgctaacgttattaggacacttaaatggatggctcacccaaa

aattacatttctgtcataagttttcaccattttacttgttcttttgttta

acacaaaataatatattttggatatagctgaacacaagtcattaatcatt

gacttccatgttaactgtttttgctattatggaactgaagtcaatagtta

caggtgttcagctttcttcagaatatcttaattagtgtttaacagaaaaa

gaaacccaaacacggtttgataacacttgaggctaagttaatgctgagta

aattttcaatcttggatgaattatatttagtcgtacttaaaacctattca

gacttctataatgattattattattaagaggttaacattattatgtattt

gttcacccttcatgatttaatgttttaatctaaagctattttaacaatat

aacattatttaatcatatatactattgttaaa