MCM3-associated protein

cDNA: Genbank AY648719

 

hi471 is in the 2nd exon

 

tcaaaatgtctgtgttcttgttcattattggagaaacaggaattgtggat

atttgttcatttcactgcaaaactttcatttcttgcatttcttgacaatc

tgctcattttgtattaactgtactttgcaaatgaattatcagacaaacaa

attaagtttttttttttgaagacttgcattaacacaaattcattgtccac

agcttgtcttatttttattgtggaatacattaagcatgccatgtatcttc

cagaaaaaagtacaatatgttttttgtgtttgcatatattgtttatttaa

aatatttagcaagttgaatgcgttaaaaatatttcccaaggcgaaatgga

cttttattcagccttttataatgaaatggagaaatgcgctaatgttgTCA

TGCTCCTGCCTGCCTGTACACGCCGCAGTCGCCAGAGACTCTCGTTGAAT

CGACGCGCCAGTTCACGAAGAAGAGAAATAAACATCCGGTCCGAGTAAGA

AAAGGACGTCGCTAAAgtatttacagtttttactcctttttaatttgaaa

tgtgcttgacttttgcgtacaaaatatagacttgaaacacatacacatat

tataggtttttaggtagttcgttttggagttaaacaagtaatcggcattc

agctctcagatcgccatttgtttttaacgatgtcccacttgagcttttaa

ctttacatttaataacttctgtcatgtgacttctaatagataaaatggta

aaacattggtaacttttctgtctttgttttgcagGATTCGTTGGTAATGA

CTAGCTCACGATCAGATCAGTAACGTTAAATCTTAACGATTGTTTTTCTT

GCCTCATCCATTATGAATCCTTCAAACATCTTTGGCAGACCACAAGCTGC

CTTTCAGGCACCGAACACTAATCAGTCTGGAAACCTATTTCAGACTTTTG

CCCAGCAGAACCCAACACAGGGTGTTGGTTTTGGCC

hi471 (5-3)

AACCTTCTGCTTTTAGTCAGCCAGCTTTTGTTCAGCCAACACCACAGCCT

CCAGTCTTCGCTCAAACACCCACTTTTGGCCAAACCGGCGGGTTATCTCA

AGGATCAGGGCAAACATCATCATTTTCCTTTTTGGGAACACCCCCTGCCT

TTGGGCAGCCAAGTTTAGGTCAGGGGGGCACACTTGGATTTGGACAACCA

CCACCACCTTCATACTCTCAAGCTACGGGACAGACTCAGAGCTCAGCTTT

CGGTCAGCCGTCTGCATTCAGCCTTCCCTCCAATGTCTCGCAGTCCTCCT

CAACCAGCTTCAGTAGCACTGTTACTAGTCAGCCTAGTTTTGGTCAGCTC

TCTGGTCTTCCTGTACCAGCGGCAACATCCATCTCCTCAATAAGCGGCAG

GGCTGAGAATCCCACAGGTGGGAATCAGTTTTCTTTCAAACCACCAAATG

AAGCAGTCTTCAAGCCTATTTTTAGTGTCAGTCCGGAACCAACAAGCACG

AATATGTCTTCTGCTTCAGAAACTGCTGGATCCTCTAAGGTGGTGGATAA

TTCCTCTGGTGGTTCACTGTTTTCATGCGTAAAACCAAGCGCTCTGGGCT

TCAGCTTCTCACAGCCGGCTGCAGCTCCTTCTGTTTCTCTCTCTAATTCT

AATTTTTCACAAAAGGAGACAGTTGGTGGTGGCGGCAGTAGCATTCAGTT

CACCTTCTCTCAACCTGCCAACCCGTCCAGCAGCAGTACATCTGCTTCTC

AGCCCACGACTCCCTCCACCTTCAGCTTCACACCCCAAAGCCTTCAACCT

CAGTCAGACACCAAAGTGCCTGCGTTTGGTGGTACTGGGATTGGACCCTT

TGCTTTTGGGGTCCCAAAAACTGTAAGAACCGAAGATAAAACGAGTGATG

GGCAGAGCAGTGGAGGGGAAACAGCTTTTGTGAGTTTTGGTATGAAACGG

AAAGAGGAGCCTGCAGATGCAGCTAAAAGTGATACCAGTGAAACTGGAGC

AGACGGGCCAAGACAACCTGCCAAACGCCCACTTCTGAGAAGCCGTGTCA

TGGCTGGAGGGCTCTTCCGTGTTGCAATGTCTGACGTCCTAAAATCCAAA

GTGAGCCCAGTCAAGAGAGAAGATAATCTTCCTGAAAGACCAGATCCGCC

TGGTCCATCTAGTGATCTGACCACTGCACTTCTGAGGCCTCAGGCTTCCT

TAGTTTCGAAAAAAGCAGAAGATGTCTgtaagtcttttcttgtgactttg

acaatattaaaattcagatgttaaaaaaaattaattaaatgctacaagga

aatctgttatgtttaacagcagattgcatataacaagagtttaataaaaa

ttagtagtttattttaaaagcattttttaagatggcaaagataatcttaa

tgttaagaagattaaaaagacacaactgaatagtatcaatttcaactggt

atagaccaatataaatatcatatataaagctactgatatgccatggaata

tttaaaaagtcattttcttaccttgttgaggtcttttgaataagaggaat

tttatgttctttaaagtgaatgtttttttgtgaaaagtttacaaatcaca

gcatttgggttacacagggcataataaataataatatttaaatattttgg

aaatattgatacagggcacagggttacttttttattatgtaaacaaatat

cactatatgtttaagacaaatggctgaaattttaatttttagaatgtaga

ccagggtttaatgctaaggatttgttttattggctgtgtcaaatttctac

tgac