kinesin family member 11 (EG5)

cDNA: Genbank AF506215

 

hi486 and hi3112a are both in the 2nd intron

 

ggcacgtagagcgtattcaaataaaccgtgttactggagggattttaAAC

TATTTTGCCATTTCTTGTGGTCTACTCTTAAGCAAGATCGGCTTAACGgt

aagtgcatttgctactcttgatactattagcttgctgttttcttagtata

ttttgtttaatcgccatttaaacttgacaaagtcaacaacgtaactaact

gttgtttgtaagtcaatgcaatgttctgtgtttatgctcgtaacttatat

gtttctatatagttcagcagtggttcaattcatgaccatttgcgaattaa

acccagtttttgttgtgaagGTTACATTTAAAGGGCATTTGAGATCTGGA

GCCTAGAAGACGCTCCTTCAACATGGCATCATCACAAGTACCAGCAGCCA

AAAAAGATGAGAAGGGCAGAAACATACAAGTAGTTGTACGATGCAGgtga

atataaatgttttatgtttatgtggtacttctttttcagaaatacgaagc

atgttttcttttggaagtggttttgtatgtttgtttttgtagttcaacct

cagaaccgttgtaacttagtgaattcgacgtatgagtaaaagacaacaat

gggttttaggcatccaaataacgtgtagtattgctttttatgtacaaaag

tgtagtcatctttgttgtaaagttggttttataatttgcccattcttact

ttctttttaaaataatataaattattaaaaactattctttgccatttcta

atattgaaattttattagcagccactcacttttaaagtatgacattgttc

acactccattaattgtgctaatattg

hi3112a (5-3)

ttttatagtcatacttttattgctatttcagactgaatattcaaagtggc

gtggtaaacaatatagggaccatgtctcaagttgtcactgaacatgtttg

aacataaaactttttctcaaagccttctttaactatctaataactcggcc

hi486 (3-5)

taaagatttacagaagtcacaacactataatgttgtcagacatgacagga

gacatttgttgatgtgttgaaagattatattggtggatatttgtctgtgt

acatatttttatatgtatatactgactcaatagttaggactgcacagagg

attgtagcaactaaactacccaaacttgatacagtttatgcaagtcattt

acacaaaagagctaacaacattagcaggacccaacctatcctggatgcaa

actttttttgtgccccttccattgggcaaatgatgcagagcagtcaagtc

atacacaaataggctgaggaacaccttccttccctgagctgtagcctgta

tttacatgtatttcttattgctgctggtctctgagagctgccaaacaaat

tttgttctactattattacaatgacagtttctttcttttttatgatagca

atacaggtaggtactgtcaagtttaaaagtattgtaaaaaaaaaaaattt

cataaatttcagtatttgcctaaaagatttaattattattatttttttta

cttttaatgctctaaaaaaggatttgttttataacattctgaccttttat

atagataaaagtttttttttttatatttatttaaagtaaatgcaaaaatt

taagtttaatttgtatgtttatttttgtaggtttaaatttacctttttta

tcttcaccaatcttatgtctgatgtgcaatttgcagACCCTTTAACACAG

TGGAGCGTAAATCTGGCTCTCACACTGTTGTTGAATGTGACCAGAACCGA

AAAGAGGTGATTATGCGTACTGGAGGTGTCACAGACAAAGCAGCAAGAAA

AACATACACTTTTGATATGgtgagtgattgccttattttaaccatccaca

tcagctttaatgatatcctgtgcagtgatgctcattgaatgtctaatttc

aaatgttttagGTTTTTGGCCCTTCTGCCAAACAAATTGAAGTTTATAGG

AGTGTGGTTTGCCCCATATTAGATGAAGTTATCATGGGCTATAACTGCAC

AATCTTTGCgtgagtatatttctttgaatatatcaatttttatttttatt

ttttattttttttacctaactgatggttttacatgttacatctatttgca

tcctgtgcatttatgtttttcctgtttgattaaagATATGGGCAAACCGG

AACAGGCAAAACCTTCACAATGGAAGGTGACCGATCACCCAATGAGGAGT

TTACTTGGGAAGAGgtaagatttgcgcagttctgaaactgtctaaatggc

aacccaattattttttgtttcatttcctattctgaattc