t-complex polypeptide 1

cDNA: Genbank NM_131230

 

hi491 is upstream of the gene

hi3564 is in the 1st exon

hi1907 is in the 1st intron

 

catccatcctgtagggtggcggtaaacgcacccaaaactgcaacaaaaca

tcatagaagaagaacaagatgcaaacggggaaatgtagttttttatacgt

caaacagtctttgtattgatatgtaaggtta

hi491 (5-3)

catacctctttatgcacgtcggtgtgcagagttgagtgtttgtagtggtt

cggcggctcgtgtttgtgtttattatgaactgagagcagttcgttagttg

attgatctggaagtttccacacgcgcccctcccgcgcccagcctacccat

aacccaccgcgcgcgcctccattcttctctccagtccaacatGTCCATGA

TAG

hi3564 (5-3)

ACAGTCCGTTAAGCGTGCTCGGCCAGAGGACGACTGGCGAGTCCGTGAGG

TCTCAAAACGgtgagtctggaagagatcataattacccgtaacataacgc

agagtgcgggtgaacagcctgacgcagctgctgtttgagcggaggagcgg

cggccggtgccgctagcagcacgtgcggcttacaggaaccacagcgttaa

cattactgatctataacactgtaatgacg

hi1907 (3-5)

ttatagacctaaatatgtctttggagtaaagttttatattcgcacatttt

aactttctgcttaatataattccagatattatttgaatatagcattgttc

acagtcaattacatggtgctaatgttgtgttgaagtc