nascent polypeptide-associated complex alpha

cDNA: Genbank AY099510

 

hi5 is in the first intron, before the ATG

 

gtggtttcttgttatagacttcagcttattcgacagtgacttcctgttgg

gaccggaagcagagcagtgacatcagagcgacgcagaggtcagaaaccct

CTCTCACAGCCATCTTGGATCCTGTGCCCTGAACTAgtgagtactcctgc

gtaaaatctattgtcatccaacgtagctttagccaattcaatacataatt

tgtagcttatgctgatgctttaatgtagctgtgtttggaatggtaaagat

ttgtaaatttgcttggcttattgaggaaatatgttgatgattacaactgg

ctgactgttcaaaatgggggagcgagacgcaccaccgctcgctatacttc

agtcgtgggctttgtgtctaacgaaaattttaaccctgcaaaaagttgca

ctatatacaactatagcgatatattgtgagaaatctgtaatttattcgta

agaaaggttgttgcgtgacgtgcgacaataaacactggctggatagttaa

cttcgctgcttaaacatgtaacgtttctataaacgcatgctgtggc

hi5 (5-3)

aacagtataacctaacgttacattataaaggattataaactcatttcttt

taaaaagttttattgtaatttgtgtaatgaggttctttcattcagcagta

gcgtgtcagagctcctctgttaagatacacacgtgaaatgtgcaacacag

tgcacgcgcacacatgaacagtgtgtggaactgtttggggacgttataag

ccttatttgttcagtttgtctgtttacaattgataaagctcacaaattct

gttcggtggccttgtgaaatgatatcatgtagctcaatactttgagacaa

cagcagtgtttaactgagccggtagtgggacagctgacagccagcagagg

cctacaggaagaggcctagagtgctgctgtttcaatagaaaaagcctcat

taacacaaagcactgactaatgcaagtctaaaccatcatgcagactttgt

aaagcttataatgtattgtttctcatttctgttttagTCCAGAATGCCAG

GCGAAGCCACAGAAACTGTCCCTGTTACAGAGCAGGAGATGCAGCAGCCC

CAGGCTGAGACGGgttagtactgcttttaaaagtgcatgtctgatactaa

acactggttgtctaggtggtcctggaaatattgtttattgtactggttat

tatcaaaatgttgctcattctattcagggtgtttttgcacctgttttagc

ctttcttcaggtttcttttagggtcttctcgcagctgttgtagaaatttc

gcataacaagtttctctagtcagagtagtgtagggtggggatacagtttt

gagtcagtttttctcctcctagaggttttaggttaatgtgcttgagctac

tccctgaataaaaaaacacaaattactagtccgtttaaaggcagggctcc

gtaataacttttgagaacagtgccgccaagttctacaaatgaaggctcca

gtatcacgcgggcaaaatataataggattgcattttttgtctctcagaaa

tgtagttaactgtagattgaggtaaacagtatgcgtgcctgttaaaataa

caaattcatgaaaacccacaggatttagctactctgctatgataaaacaa

gctaatttaaaaatattttgtttctgtggtatttatgtaaaaaaaaattt

ttttgtttatagacttaaactaattaaaattatgtgcacaataacattgt

ttatatgaaaacttgaaatatgacaaaaagttacttggattcttattaaa

cttgcaataaaaacacactggtataaatgcacaaacattagcctgtgctt

ttaatcttttaatactttaatataaatgtacattaaatataatgtataat

atattgtataatactatacaattctgtatgggtatgccattttctgccaa

aaatataacattaagttaataccgttacatttaagttaaaagtaaataca

tggatggtttacttgtttcacagtgtttctactgtttaacttgtctttgc

ttttgacagtataacctgagcctgaaaccctgtttttaaagggttgcttg

gactatattcatgtaataaaaaaaaaaaactggccatcacttttcattat

aggaaaattccgctgtatgttatcgatttaattgtttttcaaagtttatt

ttgtttcagaaaatagtcacattagtttaaaagatcatttaactccattg

accttttatttgaatgaaaatgctacatcacaaggaaatggaagaacatt

tgtttttgaagtaatccaggaccaccttggtcaacagttggtttctctgt

acagtaaatcgaagtctaacggtttgtgtgaatggagtatggacattgca

acccagcatgattttcctaactttgcacttattttagtaatcatgactca

aatagttgttactcctaggatattgtgttaggttagaaagtgtactgttt

ggttcagggattgttcaaaaaatgcaattgttttggcaagatct