solute carrier family 25 member 5

cDNA: Genbank AF506216

 

hi526a is in the 1st intron

 

ggcccagtcaaaagtcatgtgaaggactttgcactgacatgttggccttt

ttcttctcgcacacatgcccttggagatcattaaccagagaaaggcagca

acctagctagtaacaaacacgcatgttgtgtcaccttggagaacttactt

cttgacttgacagctgaaggaaaatctggacaatcctgattctccagctg

tagtggtgtgcgggtgtgtatgtttttaaatattgtaagtcaggaataag

tggatgcgctgaagcacatttaataacatctaatgttgtaaaaacttcct

gttgtcatttacgctttccaccttgaaaaggcttaaggttaccttactaa

ctttgagccattcatctccgtcatcacacgacggtcccacccctggaatc

tatgacgtttcatcgattgtccaatcatgtctcagaatctcgggtacggt

tcgtctcgcgagacgaaccttttaaaaacgtcgtctcaacttttcaatcg

ggccatttcgaatcagccggcattCCACGCTAGTCCTGCGGCAGAGCGGG

ATTGACCTCTTCAAGCGACACCTCTCCAAGAACATCCAACAATGAGTGAG

ACCGCCATCTCCTTCGCCAAGGACTTCTTGGCCGGTGGTATTGCCGCTGC

CATCTCTAAAACCGCCGTGGCCCCCATTGAGAGAGTCAAACTGCTGCTTC

AGgtagatatacgcaatgatattaacaagattatataatcccagattttt

aataattgagattacgtgatgactcaatcttgaatgctattagaacagaa

ttatgctaacgttagatccatttatgcttctataatgaaacgtaaggaca

ttttcagattttaacttgcgctttttaattgcttgttttattggacattc

gtatggataaccgccatttgtcatagtggacatcttcattagttgtgca

hi526a (3-5)

tctgagtagttatttgtttgaatgttttgatgcactttgagtcgtttaaa

accgaacagggtgtaaaatatttggttaaggatggacggggccttcggtg

cccgtaacctttacgttagcaatcctcctcgagagaacagaccgagacat

tcctcaggtaattggtgaccaaataaccgaaatgtgttattgctaaacgt

cattattgttaaattatcgttttgagaaaataatttcgagttattttttt

ttaactattacgcgaaacgcgacaaaaagcatcctccgtgattccgccaa

ggtcgcgagaaggggaggcctggatatggctaggcctttactgttagctt

gcaagctaatgctcgcgccctaggacaacgaagaccctgctattgtttaa

gaggacaagccgttttataatcgtttcacggttgtcatatacattaaatg

ttatgcgtttgttacttttacagtctttacgtcaatttaagcagttttgc

tgttcctgtcagtcattttttttgcggaaatcgcctaccggaagatgtcg

agcattttgcgcgataccggcttctttcgtttctcgttatcacgtgttct

ggttttctcggttttgtttttcaaagccgttgtctcattagaaacatttt

cgagcaggttttagctgctgctttttgttatcttagctcataaatctaat

cactgtctttcattgagacgttctccattgagtattctcattgacctttt

ttcccctcctgtttacagGTGCAACATGCTAGCAAACAGATTACAGCAGA

TAAGCAGTACAAGGGCATTATGGACTGCGTGGTGCGTATCCCCAAGGAGC

AGGGCTTCCTGTCGTTCTGGAGAGGAAACTTGGCCAACGTCATCAGATAC

TTCCCCACACAGGCCCTCAACTTTGCTTTCAAGGACAAGTACAAGAAGGT

CTTCCTTGATGGTGTGGACAAGCGCACCCAGTTTTGGAGGTACTTCGCTG

GTAACCTGGCTTCAGGTGGTGCTGCTGGTGCCACATCCCTCTGCTTCGTG

TATCCCCTTGACTTCGCAAGAACCCGTCTTGCTGCCGATGTCGGAAAAGC

TGGAGCAGAAAGAGAGTTCAGTGGGCTGGGTAACTGCTTGGTAAAGATCT

CCAAATCTGATGGCATCAAGGGTCTGTACCAGGGCTTCAACGTGTCCGTT

CAGGGTATCATCATTTACAGAGCTGCCTACTTCGGCATTTATGACACAGC

CAAGGgtgagtccatgatgca