zinc finger, matrin type 2

cDNA: Genbank AY394926

 

hi526b is in the 1st intron

 

agatcttccgtcccaacagctacactagctgtagacatcctaagtatgca

tcgctcaaggatggaggacctgaagagtgaataataaaataattaaaggc

actaacagatcatttggaattaagaaaaaactattcacaagacaaccagt

aacaaattataaaaaagaaaaaaaagcatacctgcgaggcttctgaacag

cagaaggcttttctccattttgtgaagcagacagtggggttttagagcag

ctgagggaaaaacaatgtgcagggtttctcaacacaacattttcaagttc

caccccccccaaaataataattataataaaaataaataaataaaaaggtt

ccttaaatcaacagaaacacatttacctgacaagactatcatacactgaa

ctgcagccaggaagcagccaaggctctgggctacatgggagagagagggt

tttactactgaagtcttgagcaacgtctgttggccacaagtgaagaggca

gacctctaaatcacaaaaaaataacaaaatacaaagtgttttacgatact

acatgaggacaacaacacatgaggacactttaaaggcacaaaacaagctt

tgaaacatacaaccgcgactcaaaggggctttgaagaaggctttctatgc

gtgttgtcatgattttggctaacgtacagccacacaacacattgcgcttg

acaaagctttttatcagcgacaggtgtaacgggggcggggctctacaaat

gagacaggtaaggccgctaattattaaaaaaaataataataataatgatt

tatcaaatcgatattattttaattaacgttttatttaataacggttttta

tttcactgatttaaacatgtagatgtaaaattcttgtagtgaaatagtat

gtctctatttagacacattgaagaaaattgtccaagtaacgagaggaata

atacagtaggcttgtcacaaatgtagtcattaaacaggtttttgactaaa

tgtaagcataacttatttgaagcccaaacatataaataaagtaaaaaaaa

acaattaccaagcatgatgacacttttacagtcggcaaaatagtaacagc

agttcggcaggggcgcttgtttacggcagccgcacacgctttacggcatc

ctcatagcaAAATGGCGTCAGGCAGTGGGgtaagaattctgttaagactt

gtttatatgttattttagtctatccgcttactttaaacgtaatttaggaa

agtatttattttgtagcgtcatgtgttagcaaatgttggtatcgtaaaag

gtgaatgaagaaaaaactggccgatgttgtgacgccagatggttttgttt

tgttgtgtacaagaagaaaaacagatatatttcagttgtaaagcgtttcg

ttatctatattgccttgtattatcgttttaaaagcatagttaatctatta

gtataatcat

hi526b (5-3)

attatggcttatttatgttcgatcttttgtacagacgttttttgtgcagt

tccagtagatttgcttaacgttattcaactgtcatggttatgctattaaa

atgtttaaaattaagatttatgtgggcctttaaagtttaaattagacaat

aatcccttaaaaaaggttttaaatcagcagatatttatactttctaaggc

attaaatgttgcatactccgcaaaagtttatattttcctcaatattttta

tgttttcctttataaaaatcataaacgtccttaaatgaggtttcatttac

tcgataaataatttaaaaagtttaatatattgtttgttattaaagaagaa

aaatgactttgctgtttgagtgtttatttctgagctcattttagtctcat

atctattaaaaatctattatgatttcataatctttagacatgagtaatgg

aaaggatagaacaccaaggaagaatgtgctttttacagtgtgacaaaaag

taccgtgaataatacagattggtatattcaaacctaaaagtttagccaag

tatatacaactcattgtttctgcaactcagtgtttgtatgttgtgttccc

ttaaaatgattcattacattttcattgcgaggtcttaaaaaggtccttaa

aatgtcttaaattgtaccttcatcatttacaatcatattctcgtttctag

TCCAAGAATGATTTTCGACGGAAATGGGACAAGGATGAATATGAACAGCT

GGCCCAGAAACGAATCACAGAGGAGAGAGAGAAAAAAGATGgtaagctaa

aacaaccctaaaaacccttcagtatatacagttatcagagacaaaaaaac

taaaggatcacttgtaaattctcaatttctctgaattcatgggatataaa

atgtaagatatttgttttattcggtaagtctaataatatttcttccaaaa

attaaattagataaatattgtatatcagagcttttccttttttccagaaa

atgtctattttatttaacatttgtaaaaaaatatcatcagtagttcacag

aataaaaccaaaattatgtctcactcaaacacataataacaaatgataaa

ttctgataaacgttcagtggaatttttttgtatatgtaagttgtatcttt

attcagtaaattaaatgaagtatggtcaaataaacccatatgctgacaac

aaactaaaataattctctcatgcctaaatattttacaaaagtaaataatt

ccggccaatatttcctatgtcattcttcatttttgttctccagGCAAGCC

TGTGCCCCCCATCAAGCGGGAGCTCCTCCGCCACAGAGATTATAAAGGGA

TCTGGAGTCAAAACTGGGGAAAACAATCGTCATCACGAAGACCACACCAC

AGGCTGAGATGGGAGGgtgggtgtaacctgaaacttgtatttatgtttta

gtataaatataaataataaaatattaatatactattttttttcatgttaa

gGTATTACTGCAATGTGTGTGATTGTGTAGTAAAGGATTCCATCAATTTC

TTGGATCATATCAATGGTAAAAAACgtaag