coatomer protein complex, subunit zeta 1

cDNA: Genbank NM_131508

 

hi528 is in the 1st intron

 

gactaatatgaaaatgttcatacgattaatttacaatgcagtaaagtaat

atttgctgtcttttagtaaatatatgagagacattaaataaaagttaaaa

aggtattatttattatttcatatattaagtttgtagtttagaaactccca

aattcactccgtacaaatctgcagatgggtttttcaaacaaaattctgtt

cagaaatagcaaaaaatgtccacagattctgtctggccctggttgtgacc

aataattatgtccaactgtccgacttgtcgagtaatcaatcagttatgcc

ttagaatataaacatttggggtaattgtgttgtctgtatttttctcattg

tgctgcatctgttctgcgtcttaaagtctaaagcttctgctgtttttatc

attgtcttttccatctgtgtttaatcattgttttaatccagcaaaattag

ataacaaagtggaaatgttggtcgattacactgttgtttacctatttaac

aattcccggcaaaatgtttcccgcgatgatcgatgacgttacaaagtact

tccgtttggatttgcccttttacctcatgtCGTAAGCGGATGTACGAATA

CGCAAGAATTCAACGCACGAAGGAAGAGCGAGCGACATCTGTACAGTACA

AGATGGATACGCTAATATTGgtaatatgattatttttgtttagcatttgc

attaaaaatctttaaaacatccgctggcaggtagatcttccttgtttatt

gttctaatagctcttgcgctacatccgcaaaaatagcgaatcagttatcg

agcagacgagttcagcaataacctgtgtaacgttacaatattatattgaa

gatttacattttattac

hi528 (5-3)

acccttttaggggactagtttattgatttgttgtattttggtaattgtta

ttggttatctgattctgatggacagttagactatgtcagctgaacctttg

ccctgatcacctgatctgtttggctgtaattgattggttatttgtcatat

ttgtgtgtttgtttccacagGAGCCTTCTCTGTACACTGTAAAAGCGGTT

CTGATCATGGATAATGATGGAGAGAGACTGTATGCAAAGgtgagctcatc

tgatgatcatcaagaacaggatcatatctgagttgatctacagtgaggtt

tcatttaatagttgattcttaatattgagagtccaacaaggcttgctggc

atgtatcatttgttatttaaagttacccatcgatccacacacatccagtt

gccaacatacattcaataaaacttttagcaaaattgttttcgaatattat

aacagttgttggcatgcatttacttttaaactttttttagaatgttgagt

tgaaaaaaatgccccattaaaaaaaaaatccgtagcgtttagccctatgt

aagtctgaaattttattcataatggtctgaaaagggtctttaaaaaggtc

tcaaatttacccaaaactgagtagaaatatgcaattattttaattattat

tcatatagccaaaatattgtagcttgtaatgcaattaaattagttattca

taacaatagggtgacgaggtggctcagtggttagcatgattgcctgacag

caagaaggtcgctggttcgagcctcaactgggtcagtcagcatttctgtg

tggagtttccggtttctcccacagtccaaagac