transcription factor 2, hepatic (variant hepatic nuclear factor 1)

cDNA: Genbank AF430840

 

hi2169 is in the 1st exon

hi1843 is in the 3rd exon

hi548 is in the 6th intron

 

CTAGACCTCCTAAATATTTAGATGTTTGCAAACATGGTGTCCAAGTTGAC

ATCTTTGCAACAGGAGCTTCTGAGCGCCTTGTTGGACTGTGGAGTTACCA

AAGATGTGCTTGTGCAAGCTTTGGAGGACCTGGACCCGAGCCCGAGCGCT

TTTGGAGTTAAACTGGACAGTCTGCAGATGTCCCCGTCCGGCTCCAAACT

CAGCGATACGGATTCAAAGCCGGTGTTTCATACGCTCACT

hi2169 (5-3)

AATGGACACAGTAAAGGGAAGTTATCCGGAGATGAAGGCTCCGAGGACGG

GGATGATTATGACACACCGCCAATTCTCAAAGAGCTTCAGTCTCAAAACA

CCGAGGAAGCGGCCGAGCAGAGGGCAGAAATAGAGCGAATGTTGGCgtga

gtttttacctatatacctttatatttataggcctaaataattaagattta

aagttgatcaaaaactatatttttaaaaaatggcaaaaagaattgatgtt

gttgaataattttaggacaactgtgagggaatgatcctttaaaatgttga

actataggcctacttatgttattataaaatatacttatagttacactgtt

gttatccattgctttatatacaagttaaagagattaaagtgaaataacct

gtggagcttctgaactgacagtgtgctgctataatgttgaaggccgactg

ttaagtgtgaaattaaggccgttgaagcagctgaattttccattaagatt

aaagtgcttatttattcacccaactagtcattaaatttgactaaaatgta

aaatgttcttaacctgatataaaaaaatctaatagaaaagtttaattgct

aacttctgatcttttaaatcaaaggtcattgaaatacgtacaaaacttct

tatttgacaaatgtaattaatgtctgaagttcttaaaatatagtggaatt

attttgtgacagaaataaaaatcgtagcctagttgtaatttagaaacgaa

atattttttttttcttaaataacgcaaaggagattatttcgggacagatt

attctaccggtgtttacaattttaaaagcacgcgccagtgtttcctcttt

tcacattctggttactaattatctacgtgagttatttctttagcttagag

atatatcaactaaagaagatctatttattattaaccacctctggcctctc

gaaagaaaacacaaacatgcacgctgttgtctgaatgcaggcttgtgcgt

aaatttaggccttttgaaattttttttaggatttgcgaaaatactgatga

tatatttattgtattaatatagcacttttagttataatattttgacaatt

agaaatgataactaaaataggcctaccacgcggccaataaataaaaggag

gcctataatgtggatgctatttaattcaacaagaatattatttctataac

tgttaaaccctcagaagcgccacgaaataaagaggaaaatcaaaactaaa

gcacgtggagttgagttattaattttatcctataaatcatcaactgaaag

atacacagtgacgaatgattagcgtgaatggagatctagttattcattgt

cgaaagttataaaccaagttcgagcacagacatatgtgttgtcagtatcc

aaaccaaaaccgtccggacagatttcaggagcaaaagttatttctgaaat

tagctactatggtaagactgaactttattttaatgcatgttaaaatatgt

cgggtgaaattcgctttctttctttctttctttctttctttctttctttc

tttctttctttctttctttctttctttctttctttctttcttattttaaa

gtctaaaggtttaaagtaaagttttgttttatttaacttgattataaact

taacaccctttttaatttttttttaaaagtggccaacatattttttaatt

gttagtaaatattctgttgcattaggagcaaacatgcattatatatatat

atatatatatatatatatatatatatatatatatatatatatatatatat

atatatatataatgcatgtttgcattagcctataatatcgaagttaatgt

ttagtttattacatttaattaagaatataggctgctacggcttttaaacg

gctatgtctttgtcaaattcattggtttcttttaataaaaatttgctttg

atttaagcgattttgtgtctaacgcaacatttctcttttctaaaatacgg

agcaatgtttaaaatgtcgaactacactttagtaccttctttagatttga

aacaaattgctttacagtgaccacaatatacagctgccatgaagtcctcc

aattgtcttttacttgtccttttgtaattaaatcacggtagttgaattgc

acgcacgaaatgaagtctttaacctttggaattatttacaacccattgaa

tacactgattaactattgtttattagcgccgggaacaattgaccgcactt

gcaaaatttagaacatgttaaagagtgtcataaatataaaagaagtgaaa

ccaaccattaaacacaactttttaataggactgtattaaatgagagtgtt

atgtttaatgtttccgatcttttcagGGAGGACCCGTGGCGCGCGGCCCG

CATGATCAAAGGCTACATGCAGCAGCACAATATCCCTCAGCGCGAGGTGG

TGGATGTGACGGGCCTGAATCAGTCGCACCTGTCGCAGCACCTGAATAAA

GGCACGCCTATGAAAACGCAGAAACGCGCGGCGCTCTACACCTGGTATGT

GAGGAAACAGCGGGAGATCTTGCGACgtaagttaatatttgtttcttgtt

gcatgtgacggttttcagtgccaccgttggaatattgtaggtcatataaa

acgtccttgttcagttgcatgaaatggaatttatgactcgagtgtggcag

cactttaaacctgattttttggggaagttaattaaccttttgatgtctgt

ttgaattatgaagataatctaaaataagttaccttctaaataatgcacct

gcgcgatgtgtagatattgataaacatttttaggtgcgtacttattgcat

catcgcttttgtcacccattttgaaattatgttatcataaaaagcacaat

ggcatataaggggacagtggtatgaatcaaaggtcatcactcattttttc

tgtgtaagatcgacaatatgatattagaaaacataactaacattttgtta

aattagtggggttaatttgtacctcattctgattttattgttttaaaaat

tgcattgcataaggccaactctaaattttctcaacatttactcttacact

ccaaaaataactcataattggatgaacttaaattaattcagaattcctat

aagtttgtttagcaccaactaaaaaacaatttacacaataaaatgcaatt

attttatcaaataaaagtttaaatacagttgtatttttatttatatttta

ttagtctttcacaaggctgggatgattttaaataataacacctgctcatg

gcacacttgtcctactttgctcatgtacggtggcctggaagtgcaaaaca

acattacaaagtgtaaaacacttttacatagctcaagacaaatttacatt

ttgaaaaacatttttaactatcatcagacacaattacataggaaaaacaa

ttttaccaaggatgaaacaaatttacattttagaaaaaaatttacaagat

ccaaaacccttttacaagtcccaaaacaaatgtacaagtacagattcctt

acggaaagtacaacacaccggaagtgacgtggaatgtacaaaaaccagga

gtgaccaggaatgtaacacacacgggaaaatatcaataatatctagctcg

tgtgtgattttgtagatcggtttccatgagtctacaactataaaaatcat

ggtttgaccaactgcgattaaaacatattagagctattctgagaaaatat

cagcatgagagtatgtagaaacatgtaaacccaaatacatggaaacaatc

aaagcacggcacatgttgactgataaagatatcaaaatctaccctgacct

gtagaccagggtagctcatttaggaaggttggttgaaacttgtgcagacc

cttttgacttgggtttgaatcccgttgatgacatataaattataattatt

tctttacattaattttgattaaataccgttctgctacacagatattaaag

taataagaatcttttttcggtatgggcatgttttgtggctgtgaaaaagt

gacgaatatgccaatctgcaaacgtgaatagtttacatctgaaaaagggc

ctcatttaacacggacaccagttaaaccgtaacaccgtcttcattcagtt

tactgttaagagtcctcaagcagatgtttacaccgtgtagacttgatatc

atgtccatgataacagcgtacgagtggcccttgttaaaatattgagcaca

ttggtgcagtgtgtctggtattttcgtctggtccgcatcctttataaact

ccaaacaccgaccacacgtaaagaaaaactgtgttaagctgctcatgtgt

atgccacaacacaggcaaaacaaccctcgacgctgtccatgttcggtcac

cattaactttgtttgcgccatgcatgtactctacagcacaaatttacatt

ggtacattccctttccgtaaggaatctgtcattttaaatttgtttcggga

cttgtaaacgtgttttgcgtcttgttaatatttttggaaaatgtaaattt

gtttcgtccttgataaaatagtttttcctatgtaattgtgtccgatgata

ggtaaaaatgtttttcaaaatgtaaatatgtctcgagctttgtaaaagtg

tttcacactttgtaatgttgttttgcacttcccggccacaatactcatgc

tatgctcatgtcctatatgaaaattctacatgtgacgctaatatcctttt

cttttatgtttcagAATTCAACCAGGCCACACAAGGCTCTGGCGCCACCATGTTA

hi1843 (3-5)

GACAAAGGAAATCAGGATCAGGTACTCCTTTTTTTCTCAGAGTTTAGTCA

GTCTGGGCAAGGTATGGTCCAGCCAGGTGATGATGCTGCCATTGAGCCTG

CTTGCAAGAAGCTCAGACGCAACCGTTTCAAATGGGGGCCTGCATCCCAA

CAAATCCTTTACCAGGCTTATGAGCGGCAGAAGAACCCCAGCAAAGAGGA

GCGAGAGGCATTGGTGGAGGAGTGCAACCGgtaagatgaccttgctctga

atgtcaaaatatattactcaatttcatcccagttaatatgctaatgtgtt

ttccttgactacattcagGGCTGAGTGCCTCCAAAGAGGAGTGTCTCCAT

CGAAAGCTCATGGACTTGGCTCCAACCTGGTCACAGAGGTGCGAGTCTACAAC

TGGTTTGCTAACAGAAGAAAGGAAGAAGCCTTCAGACAAAAGTTGGCTAT

GGATGCCTACAGTGGGCCAGCGCATAGCCTAAACTCCCTCCTTTCACATA

GTTCCCCGCATCACCCACAAACTAGCAGCTCCCCACCAAGCAAGATGCAA

Ggtactgatacattcactgtgagcttacatgtgttatttgattcttcctg

gtaacctttgaatgttgctttgagtcagaaaataaaatcactgagctttg

gcttttctgcggtttagtctagaaagaataattagcacaagccccattat

aatcactccaccagttaaagatgacttgacacagttgatgagatcagagg

gaaagcaaagaggagagcagtgatcaatgagagtgacagagtgagctgag

caaatggcattgttattcccagctttgaaacacacaccaagaacaatctg

cattgtacctgcaatctcagctcgactgaagtcagcaggcaagagtgaga

cacaaagagcagccacccttggacaggacacagggtcaaccccaggtcat

gtggctcagctcgctctcgaagcctagttgtacctgtagggtcactgtgg

tttactgcatgccccactcttgtgttatctaatgaattgtattcccagaa

ggatttattgacttagtttgatatggcaagactaggctgtaaaagcaaca

cagtctttgaccgaccagcttattacctactgtttctttcatgtctgagc

gctaaagagtcagagtgctctttttctgtgggtgtgttgcttgtttctgt

gcatatagcactgcaatgagtggcttgtctgtttgcgtgtggtgtttccc

tttgcacacctgaccagtcagtgacctcaggttgtgtgttaatttggttg

agaagggggagcaacgggatggagttggtctcttccatgcttttagtcaa

gggacttacaaggtgtcctgccagtggcctgccagcagcatcagctgttt

tttggtgtcagaagctggcctgaaaataatagcacagcaggacccctcat

cacgttgccagggcacagcctgtattatgcatgcttaattgacaattaaa

atcctctgctactacatctcccagtcctttgataagggactcccctcttc

cctgctctctttaccctttctcagcagggaatctttttgtctgtggcata

ttagaagactgtagtgactgtaaccaaggttcatttatctctgctgggcc

agggggagggacacctcgaagcccctctcacctttatgggctgtggttta

gaggcagtggctgtgctctgagcagaacagcaggagctgtccgatggact

attggctctttttggaccagacaggactgatgagtctcttcttctgctcg

aggtatagaaaagtactgggtgattccctgtctcagccccctcttggaaa

ctacataaaccagggttttgttaaggaggtcgttaccaggtcacatcagt

gagagacttaactttttttattgattcaggtttggcctgttgataacaaa

caggccagttcgccgccgttagaaggtcaaccgatatatgcgttttgggg

gctggttgtggtcttccctatgtttgtgttgtcgtcctgttggaaagcaa

actgctttcaaaatggtctttgatcctgtttaggcatgttagagtggttg

tttaactagcttatatcatttttttgagaaactaaaatgattaattaaac

aatatgacccctgaacataatagtgaaggacaagcagaggacaggacagt

ttaacttgtcttgttttggactgttgggggcaatagaaaggctgaaaggc

cacatacgtcctgctaagacccaggaggcctatcatatgcggcagtgcta

taatgagcactgcctggggatgaagagccaggctttgatattacatgtgt

cccagggagagctgaaccctttaaaccagttgaaccctcctgcttccact

ccccttcagcatttcccgcaaccctctgtcattttaaccaagttttgtgg

tagcatttttttacaggtcaaactgtattgtgtgattaccacaagcatca

tgaaacctgaaaacaaatttttgagtagtgataagctgaaatattttgcc

aatatgtaactgttgtctatacttagtcaagacgctgattttagcattgg

tcactgaatggtgcacattgctttactgaatagtgtaattaagacttagt

ttatgatgccattccatgtaacttttatgtcgcgttctcagaggttgtac

atcggtttctggtttcctcagaaaccgagccctcctgctggtcagcatgg

cccagacagcacagacctgaatgattgaacgtgagaggagatccctgcag

tctgagtgaatgcctgatagagtcagacaatagtctgttctttccctgac

acttttagtggttgtgcggtagtaaagtaaagactgtttatagttgctgg

cctattgtgtgccaagcaggttgtaggcccaatggagtgctttattgtcc

tgagctggcgtttacaagacattgtagagagctggcaatgttgtaagtgt

gcaaaggggttgtatctgtagttccgctacacaacaaaactcagcagagg

gattagacttttctgtcatttttttttgctgccactagttgtactatttt

gtgtggcacatctatttagaaaagctcagggaataatcccataacaaata

ataaatatttattttggctgggtcatcatcttgcttggctgcacaaacct

agtatttaaatgtaggagtgaaactatgtgtctgacattagccttaattg

agaaatgtttaccttgttcatatctgtggagcgtggggtttttcaaacat

ccattcgatagaagacaggctggattcctgtggccctccatagtcaagaa

tacccaacaaaaataaatatgctaaaagagaattcagcttaggttgaaca

taattctctcataaaactttatttcatgtagatcaggaatgttcctgcag

tatgtccaaactcggtcctggttggccggtgtcctgcaacgtatagttcc

aacccaatcagactcacctgggctagctaatcgagctcttactaggcttt

ctagaaacattcttgcaggtgtgttgagacaagttggagacaaaatctgc

aggacatcgaccctccaggaccctccagaagtttgaacacccttggtcta

atgggacaggagataaactctgctgaaagggggccctccaggagcaggat

tgtgcagcactgatatagattattttaacaaagttctgaagttcagcaca

acatagttttttagagttgcagacagctcacgtgtacacattgagatgac

cttgaccgttcagccaccagatgtagaggcccttgtttgtttgctcttcc

aaacttgtcagtgaccaacaaatactggctgggtcacattttgtaaagca

gttagacgattaaaactaaaactaatttatctcttccttcctttacaaca

gGTGTCCGGTACAGCCAACAAGGTCCAGGTGAAGTCACTTCTTCAACAAC

GATCAATCACCATAGCAGCAATGCCATGTCAACCAGCCAGTCAGTGTTAC

AGCAGGTCTCTCCAGGGGCGCTGGACCCCAGTCACAGCCTCCTGTCACCT

GATGCCAAGATGgtaagcacttccaacactgataagataacactatgtct

gctcttgacacagtaacacaaagtagcgcttgatagatatcttcacccag

caagtgggcttacaattgctgcattgtacttcccagtgctaaacccaaag

ctagacggcaggccttggcccacagtgcactgcagggctgatcttagtaa

atgttagctggtggtagtgagaatggggcacggccatggctgtgccaaca

aacctgacaaagagacattctgtttgtattgattaaatgccgcgcagagg

agaggaagggtggagttgtgcttgttctctgttggttgagtgacactggc

gctcaatggagttgcttatctgaatactaatgtttgagttgggcgagatc

ttcatgtagctttttgtttcaggacaattttctgtgcattaatttttcta

gcaaggctgcagtgttacactataggtcaaattcatcatggtctagggtg

cgtttctgtcaacagccagttggaagttggcgtaggaggaagggagtatg

acagcagcttatctgagcagtcagacgtttgtctgagcatggcctcctct

caactctgcctattcaaataaagctctgtgcctcctgtcagggctctgat

actttcttaagataagagtacaattctgacagaagcgttctagtcattct

gatgaactggtggtgtattttcttcac

agATCTCGGTATCAGGTGGAGGTCTTCCTCCAGTAAGCACCCTGACCAAC

ATCCACGCATCCCACCACGTGCACCAACAAACCCCTAACCTCATAATGCC

ACTCTCTGGAGTCATGGCCATTGCACAAAgtgagtgtccatccacatttg

gtttccttttcagattattcatacattctcctcttgacgtcgtaatattc

ttgcattcagGTTTGAACACATCACAAGCACAGACGGTGCCTGTCATAAA

CAGTGTTGCAGGCAGTCTGGCAGCACTGCAGCCAGTGCAGTTCTCTCAGC

AGTTAAATAGCCAACACCAGCAGCTCATGCAACAGTCATCTGGACACATG

AGCCAACAGTCCTTCATGGCCTCTGTCTCACACTCACACAgtcagtctac

hi548 (5-3)

tacctctattcagtatttattgatctagtcaggcctacatcataaagctg

tagatgtaaactgctgtttgtgttatctttacagTGTACCCACACAAGCA

GGAGCCACCCCAGTATTCTCATTCGTCTCGGTTTCCCCCGGCCATGGTGG

TGACAGACGCCAACAGCCTCAGTACACTGAGCTCAATGTCCTCCAGCAAA

CAGgtcagtaattcaa