ATP-dependent chromatin remodeling protein SNF2-related protein

cDNA: Genbank AF506217

 

hi550 is in the 5' UTR

 

agatctagagatgtacataatagaactatatattttttatttgtaatgca

tgaaagacatatacagaacaatgtcgggggtgtacataaatatatatgaa

aagtataacatagttaaatataagtacatagattcaataattatttaaaa

aaatatatatattaaaaaatattacaaataatactaggccttgctaattc

acaataacttaagtgtgtcaaacaaatacatcggttttacagctttttgt

ttgcatttccctgtttgtgtgacgtcattggtgtgaaagtctcgcgattt

tctacagccgggcccgttttgcgggaacggtgtcaacaGAAAAGCCGGGG

ACAGTGAATGACGCGTGGTGCGCTTGCTCAATTTGGGCAATATTTTGAAA

CTTTCCAATCAAAC

hi550 (5-3)

CAATATACTTTTTCGGCTTATCTGACATATTTTTAACGGAAAAACTCGGA

TCCATCGCGAAATAACGGAATTATCCAGCCTATCATGTCACAAACAGAAA

GCAGCATGGAGCAGCAGCGGGAAGAAGAGCCGAGCCAACTCGACCCGGCC

GGTCCGGCAGAGgtgaggggtccatcaacaccaaataacaccgattatga

ctttataaatcgtctggtactattaaacacagactgatggatctggaaat