nucleoporin 205 (c7orf14)

cDNA: Genbank AY648720

 

 

hi2352 and hi2720 are upstream of the gene

hi557 and hi2992 are in the 1st intron

 

ccatggttttattatagtaaaagttcactatgtttttgcctcgcaaaatt

gactgagagtctcatttgaagttctgtaaaaaagatattgtgtttattat

tattcctgatttcgatctttgttggtgggtttgtaggacagtaccaccct

ctggtgctagaaaaatgggatattaataattttcaggcagtatggggggc

atcagtcgctcaatttcactcaatgtcaactatttcgcttggtggctcaa

aaacgggtccgtccattgagtcgtgtgaagttctaagggcgtttttttgt

ctaatcaaagatacacgctggctaataatataaccttttgtttgtaatgc

ttacccaaaccgacattcgttaaacaaatgcaaattttaaagcaattttc

cttatgaacgtatttattgaaatggcaaggcgctgtaatcacagatgact

atgatttgtatgatcttaaatacggtgagaaatataacatgcaccacgtg

acaatgctgcctacgttgagcaaatgatttatgtgtaaatagctgtcagg

acgatcaatttatttgagaaaactatctatacaaataaaacataaaacat

tattcaccctgaatatgtaaaattagtagcaactttcgtagtgtcagtat

ccgcttgctattgtagcaaagaaccaacctgcatgctgattctaccaact

tctatttctataggtcctacgctcatgtggtatttatggcaaaaacacaa

caaaccaatgttgtcaaaa

hi2720 (3-5)

ataaaaataaa

hi2352 (5-3)

caaataaataagcaataaggcaataaataagtgcatacgaatgtaaataa

ataaaatctcttcacaaaagaaaccgaaagttatgttttcacaccggcag

aattcagggcagcccACTCACGCTTCAGACATGGCGACGCAGATGGCGGT

AAATTCAGgtattaatgtatacatttcgtattcttacatatttaatgttt

tatacgatatataacattgacttttgtgttagcacgttaaaccaaagtat

tttaatacatttaaagtacaagtacttcgtcagccattcactttatcgct

accttcaccagaaaataggcttagagtgtgtaactaaatgcgcaactaac

gttacattgcttactattatatgggctcttcttaaacgaggtattattaa

agtaaaagtctttgtaaaacttgttcttttgtgcgaccagaataaataag

ttgacgttatttaaaacatcaatgtctcctaacatcaatgtctgtaattg

cctcgtgaatatgccctttacgtctaataaaaatgatatatggacaagat

aagactaggtt

hi557 (3-5)

taagtctaaagatactttaatgtctatatactagttacgtttatactgtt

gtttagtggtttacatattattg

hi2992 (3-5)

aggtcaagttgattttatatgcgcacattcgttcagtggcaacttgtgac

atgctttctgtattgtttttaacgtggttactttgaatattgggtctgaa

atcacatgtaggtttgactttaaacaacattaacactatttatttgactg

tgaaatgtggtgtactttgatagtcaatgactgctaatatgatttcatgt

ttataatctgcaaaaaatactttctcgaaactatattattgaggagaaat

ctgaatgtgtgaatatacctttaactttacctcaatttaaatattttgtc

ttccattttacatttttcatgtatttgtttccttgttttgtaccttagga

atgttgttaatgattgtcagtgaaatgaaagttaatgtctgtgttttatt

atgtgtctttgtttaccttctgcaattctactgtgtaagttctacctata

agtcgaggcaactggttgctctgcttttgagatacttataacatttagtt

ttttgttttgtctttaaaaaagcacatttgacagcttgagtttttttttt

tttttttacctttataggtcatgatagtttgtgaaattgacaaaagcact

agcctgaagtagggctgtgcgatttggggaaaatatctaattgcgatttg

tatttttttatttctgacagatattgcgatttcaatttgatttgcaattc

aattttgtagtcaaacttcagctcaataaactgtattgtagcttctgtgt

taattaaaatgaagaactaaaaaaaataatagcaatagtaattgcaaaca

acctgaaattgtactttgctagctactagattgagtgtcacagccaatac

ttttagttgattttttttagcaagacacttctcatatagcggcctgtggt

gcatttttaggtgctggttgctgtatgtcctcatgctgtgggaacaattc

tttgacagctcttacaaattgcctgtttgtgttcggtgtctgtgactttg

aaaccaaaatattcccatataacagacatgctgtttttctttgatataaa

ttcatctataatgcttttgaagcggcagatgtcatcatcccactcgtttg

cgctttccttttttttttcttttttattgtgggctttacatactttcagt

tgagcaattctgattggccagaatgaaagtgtgctcactcagtaagactg

tctagtaagactgtcacacacagacggcagtcacacatttgctctgggtg

gaggaaattaaataatatatttcatatagcagcctcttgtgattgcaatt

cgatttcgattaattgcacagccctagcctaaagtatgaaaaacactagt

ctgcactctgcagacacttaagaaacaggagggttgaagtagtctgaaac

aaaaactgtaaaactcaaatcgcaaaacaaaatgacaaaaataatcagtt

gaaaacagaaaaattcaaactattatatagttgcttaatcatacgtcaca

ctgacaggaggaaaaatgtgaaaaagcaactttttcagtcactaatatag

agaaatgcatatgaagagtttagatgcaaaaacctctaaaagccatctga

tgttttcttctaaaactagcatttttctccgactcgtgtgttggctcatt

cattcattcattttcttgtcggcttagtccctttattaatccggggtcgc

cacagcggaatgaaccgccaacttatacagcaagtttttactcagcagat

gcccttccagccgcaacccatctctgggaaacattcacacacacactcat

acactacagacaatttagcctacccaattcacctgtaccacatgtctttg

gactgtgggggaaagcggagcacccggaggaaacccacacgaaggcaggg

agaacatgcaaactccacacagaaacgccaactgagccgaggttagaacc

agcgaccttcttgctgtgaggcgacagcactacctatgtgttgggtcagt

aattttacatttatagtgatggataagttcttttaatcgcctttcaagtg

aaataactgaacataaacattggaggttaagaaaatgtttctttcattta

gaggtttttgcatctgaactccttatatatgtatattgtaaagagattgt

ggttctgtttgcagGAGCCAGTCTGTGGGGGCCGCTGAAGGAGCTCTGGG

AGGCTGTGGAAGGGGCCATTTGGAGGCGTCAACCAGAAAGTGTTCATCTT

TTAGATCTGCAGTTGAAGAAACACAAACCCTACTTCCTCAACCTCTTTAA

AAACCCAgtacgtatacaataatctgaccaatatgataatggcataactg

tttggctg