valyl-tRNA synthetase

cDNA: Genbank AF506219

 

hi558 is in the 1st intron, before the ATG

 

ctattcaaaataacaaaatgtttttgacagacactgtcatacattgtttt

catcacaaaagttatgctatctttgaacaattaagcaataaactttccta

cctgcttatttccaatggtttacatcagatggttttgtttatcaggcacg

ttcttctgttattgcgtcagacgaatgcgttttacgacagtgtatgttgt

tttacggcattgccgaagtaagcgttggatcgcctgcatgctggatttAG

GCTGACGTTTCCGTACTGCTGCCTACAGgtgagtaacaaatgatcttcaa

cgacactttaacatataaagacactaccgtatttgtgttggtcagtaaaa

ctgcaagtatgcatgtcctccatgtggtttcttgactttggtagtcagag

ctgtgctgaaatgaacagatcat

hi558 (5-3)

acctttagccaactagccggtttatctttagacttcaaaatactcgagtt

attaatgaaacattacagtataatataaaaacaaaatggttactgcttat

tttgtggatctataatcaataaatgtaattaaggggatgttaaatggtgt

acgttaacgttaattctgttctgaatatcatctgacagtctcaggcagtc

aagtacgttagtttatcatttgcgtactttcataaataattattaagctt

atattaagtaaataagcagttaaatatatatatttttttaaataaaaaag

atttgtgatacatattaactttatactttcattataattccatcggattt

atggtaatttgcatattttccatcttttccaatgaccccatgatgcttac

agaggtaaaggtggttttatattcggatattcagacattctccttaaaaa

tacaatttcagaaaagtaatatttgcaaattgtaaatagggaaatcatat

tagtagcaaatgactatcaacgtacagcactgtttacagtgaattagata

gtgttaacgttgtttagaagtaatacttgcatgctaattccgatcaaata

ttcaaaggaacatggtaaactatattgaaactgccaaatgagcgaatgta

tgaatataaaaccaactctacctctatatgatgctttgtagctattatgg

gcataactgtaaacagtcagttaagtttttcaacaaactgggtatggtga

tgtggctttattctcctcagccatggaatgttgaaggcagtttattagag

accacaaataacaaggtcaaacaaattttccacaactaaattatgaaaga

gagctttaatgttaattgatgtatagttggttacatagtcaaacgtttat

tcatttttgaacagtgacatcttttgacaatgtccctataatgtttatat

aacatgctactttgaatattaggtctgaaatggcatgtacgtatgcacaa

cattagcactatttaattgactgaacattgttgtacttttctagctattg

gctactaatatgatttctctttagaatttgcaaaaaatacttttctggaa

gtgtgttgttaaaaagaaagtcagaatgtgtgaatgtaaagtcaacttta

cctcagtttaatcttaatgtacaacaggcaatacaaagataaatttatct

ggggaaaggaaactctgtgaactcaaaagaggtttttgatactgatgtct

cattaaaatgccaagtataatgttattttcatgacagataaaaataaaat

gcaaagaagccaaatgtagcataaaaattttcattatgcatattgatcat

tatttgtagcttaactttatttagattaatttaatctcttttgaatggaa

gcttcccaaactaaagtgaaatctattatttgaaatgcagcagtttcaca

cggcaaaaagtgaattaagttaaactgtttaattcagccgtgacacacat

taaagacacacactaaagaaacaattttttaaactttataaatattttaa

ttaaattaaagtcctttaaaaatgcaagaaattctatctggcgtaaaaga

tgacatggccagagaagctcatatggcaataagctcaaaatgttcactct

cacacatacactaatgcaaaacttgaaaattttatacattctctaatatt

ctgaaatcagaaaatgctagttaatttattgtttctctcctttagATGGA

CACTCTCTACATCTCTTCCCACCCTGATGACTTCAGGAGTTTGTTGCCCT

TGATCGCTGCTGGATTCTGTCCGTCTCCTCCACGAATTCTCCACCAGGAC

CCTCCGGCAGAGGTGGCCAGATCTCGGCCTGCGCTGGTTTTAGCAGGTGC

GGGGGGCACTGTGCTCAGCGGCACCAGTGCTGTGAGTTGGTATCTGGCAG

CAACAGGCAAACGAGCCGGAAGTGATAAAAAGCAGGAGAGTCAGGTGTGG

CAGTGGCTGAGCTTTGCTGAGAATGAGCTGACGCCGGTGGCCTGCGCTGT

GGCCTTCCCTCTGCTTGGAATCATGGGAGTTGATAAGAAGgtgcgtcttt

gtgctcacataatcaattcaattcaattcagctttgtttgtatagcgctt

ttacaatgtagattgtgtcaaagcagcttcacataaatggtcat