CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)

cDNA: Genbank AY648721

 

hi559 is in the 1st intron

 

tttttgctagttacctgttataatacggcactgtcacagtggtgtcatag

aacagctgatctgaggtcagctgcggcctgtgaccgcgcagactgagcgc

ttgccaattaaaggggaggattcattctgcggcgtgcgcgcgtacaggaa

acatgacgtcacgcgccacgctcatctacagtcctccagcagtcAGAGGG

AGTTGAGGGAAACAGAAAGCTAGAAGACAAATTCAGGGAGCTCCGTCCAA

AGAAAGAAACTCTCGGCATCATGACCGAAGAAAATATATTCCTGTTCGTC

CCGAATTTAATCGgtgagtgtcagtcgagcaagttgacggaaacagat

hi559 (5-5; tail to tail tandem)

cgtcagcgcgcaatagagttctgcgcacattcaacggcagcataatgaca

acaagtaatggtgtttcgtgaaaacattaatatatagctcataaatgctt

tcttcgtgatgttttaaagtattgtaaatgattgtgacatcggttggttt

gacttcctgcggatgttttgcgtgatgctattggctgttatcgtaatcca

tgaagcttatttgatggagcacatttatttactaatactgtaaatacagt

gtaaagggttaaagttggcgtagtattacacgttacaaccaattaatttc

aatcattttcattctaaatgcagaatatatattatgaatatctgaaccat

gtgtcatttacatgttatctcgctatcctattttaaaacgccttgatttg

acctttcattcaaatctactggcctatttctagtgacgtatgcaatcatt

aaaccaacatttgtttgacttcactttctcctcctggtactataaaacat

tttcagtgatctgaaaacaagtgtgcagcgtagacaaatgacccgtgttc

agatgtgtttcttgtaagcacttgtgtgcattaatttgtagtactccctc

ttatttcttcataatttaacagtcttgtgcaagttacttctaaactgtaa

tacattatgcatttcctgtttctgttatttaaaagtaatttcccacctta

cattattactgtctcagagtcaaacctcatttattcattcattttccttc

ggcttagtctcttttttaccaggtgtcgccacagcgggatgaaccgccaa

cttatccagcacatgtttaatacagcggatgcccttccagccgcaaccca

atactgggaaacacccatacactcacgttcacattcatacactacagcca

attttagttcattcaattcacccacacggcatatttttagactgtgggga

aaaccggagcacccagaggaaacccacaccaacacgggtagaacatgcaa

actctacacagaaatgccaactggcccagacgggactcga

accagggaccttcttgctgtgaggcgacacagcaaatttccactagatta

tcattgggacccccacttttagaaccactgttgtgtactatatacaattg

aagtccgaattattagcccccctgtttattcccctaatttctgtttaaag

tagagatttttttaacacatttctaaacaatagttttaataactcatttc

taatcactgatttttttttgtctttgccatgatgacagtaaataatgttt

gactagatatttttcaagacacttttatacagcttaaagtgacatttaaa

gacttaattaggttaattaggcaagttagggtaattaggcaagttattgt

ataacgagggcttgttctgtagactatcaaaaaatatatatatagccaat

aattttgaccttaaaatgtttttaaaaaaattaaaaactgcttttattct

agccaaaataaaacaaataagactttctccagaagaaaaaatagacatac

tgtgaaattttttttactctgttaaacatattttaggaaatattttaaaa

ataaaataaaattcaaagggtggctaataactctgacttcaactgtagct

ttggaagtggcaatctattcttctaaacttcaatttcactgtgtaatttt

caccataagagggtgcttattcacaacaaacaacggtgtagtttgatgac

agacaccatgattaagtgtggaaatatgggagttgtcatctttattacat

cctacaggacgtactgtataaggatgaatggaatgaatcatgagactaat

gagatgaagcacgaaagccgcagatcatttaatatatcaaagtccaccgc

tcacagtttattgctcatgaacttgtgaagtagcagcgctgattgattac

accaaatacattttaagattctgtgaaaaatgctgctctatgcagtctaa

taaaatgcacaacactacatctttggtgttttcctgttttctataaagcc

aaaccagataatggggttgtatgacgtcattgttttggagaaacaaagca

tggcccatgtcactagattaaatagcatgtttcttgggatttgagcattc

tttgaagcaattgtgaaaatgcaagtacattagttttataaacttcttct

tctttggccttagtcccatatggttgcggggtcggctcttttggaacaag

tcctccatttatcgtggtttaaggcttggtcaggatgaagtcgtgcggcg

acaaggtcgtcatgtaacgtatcaagccatcgctgctttggatgaccttt

cggacgttttccttcaacattgatgttgacgcccttctttgcaaaagact

attcgcttgcacgtagtgcgtggccataccaccgaaggcaggcttcttgc

attttgtctctgattggtgctacaccatatcgctgtcggatgtcatcatt

gcaaattgattggtgattctgctgatccatcgccgcattttcgtttccct

cacagcgagacgtcgttcggcagtcttcgtgatcggacagcatttagctt

catacagggcgacgggaagaactactgctcgattgactttcgatttcaga

taatccttcatctgacggtcgcagagcacgccagttgtcgcaggaaattt

tgtccatgtggcattgatctgcgcagtgatctcaggtcgcaggtcaccat

cagctgtaatcaccgatccgaggtattcgaattttttcatgcgtggtatg

tcggtgccactgacatttattgtgccatcttccttcgggtttgtcgtcaa

gtactcggtctattagtattataaacatataacaccattctaatgttttt

taataacttttatagtgatagttcaaccacaagtgaaaatagtcagcatt

ttcttaacctttacttgaaaacctcttagactttttttcttctgttgcag

aaaaaataatatattttgaagaaatctgtaaacctataaccactgacttc

catcgtatttgtttttcctcctatcaaagttgatggttcgacgttttcag

ctttcttccaaataccttcttcatatttaactgaagaaagaaagtctagg

agattttgaacaagtaaatagtgagtgagttcccactgtacactcatgct

tcctttgtatcttttcccacacgtttaatagGATATGCCCGTATCGTACT

GGCTCTGGTGTCCTTCTTCCTGATGCCCTGCTGCCCAGGCCCAGCAGTGT

TTTGTTACCTGCTGAGTGCCCTGTTGGATGCCTTCGATGGACACGCAGCC

CGTGCGCTCAATCAAGgtcttttgcagctcggtgttgtacattattcctt

tttctg