FLJ20508-like

cDNA: Genbank AF506221

 

hi2677d is in the 5 UTR

hi572 is in the 1st exon

 

tttataaagacaaactggagtgaccttcatcatcaaaatccagcagaaaa

gcctcaagttgggcgctttgggattcttcttgcttttagcattctgaggc

gctttctgggagccataatcaacctggaaaacaaacacgacacggtttat

tgacaaaatctgacacaaatgtctgagatttaaagagattttagcattaa

tttagacactgttagcttttatcgtagcaaacaactagctaattttgaac

ttttactctcctatttcatcttattttcgtcatatttcattaccattagc

acattctagtaccagataataatataaatgaattcagtttaataatataa

tacaaaattaacttactttactcactctttccacgtctgaaccgtgtctc

tcagtcagcggttagaatgaaaacccttttcaaattgaacgcttcgcatc

agcgaaccaatcagcatgcagcatccgtgaacatgcgccatgctttgacc

aatgaatcatcgtctctctttaaataaagaatctgaccaatggttgagcg

ctttactgttccagccaaagaaacaaacacgcggattggtgtatgaccat

aatgtttacatttacccggaagaaaagtcgaccgctgtggtcacacgtgg

ttttactttataatgaaaacaggATTG

hi2677d (5-3)

TATTCACTCTCGCTAAACTTAACAATGATTGGTCAGTGTAATAATGAGAT

CGCAGAGTGTGATTAATGTAATCGCTGTGTTTCCGTCAGTAATGCCCGGA

TCAGCGTTGTTATCGCTGCAGCAGGAGCTCCGGCGGGGATTCGAGGCTCT

AAAGGCCGCCAAAGATACGTTTGATGGCGGTCATGCGGAGTGTCAGGGGC

TCGTCTCCTCTCTGGGGAACCTGGCGCTCCAGCTGAAGGCTCTCAAACAG

GTCCAGATATCCGAAACTCCTCTCTCCG

hi572 (3-5)

GGTTCCCATGTTTACAGCAGCGACTCCATTACAAGCTCTCGCTGGCGGTG

GACGCACTTCTGGCTAAACTAGCCGAGAAAATgtgagtttcatatgaaag

tcattactgttatacttaatatactccaatggacttgtattatacagatg

tacagcataggagctaacgttattatggaaaaaacaccttataagggttt

taatcacagttgtgtggcaacagtctgtgaatatatccagcatctaatag

taaaaatgtattaattgtgtttgttctaatcagatttgatctaaacagtc

tgcaaaatcactttgattgacgttctcctttcgtaagcgtcatcagagag

ttaaagctccgcccactagtgcccatttttccctcattagcataaacaac

agccctgagtgagaagcagccgtctgtctattagccagtagagtgtttga

tgataatgtcagactaagatgattgtagatgcagagttttagatgaacac

aaatgaacagcgacaggagtcttcctagactgacagaaacataaagcaca

ttttcagacagataacattagtcctggtgtgaatttgtagctccgccctc

atctaaaatcagcacactctcatttgaagtgttgtgcatctgatgcatga

gcgttaacgcacacatgatcagtgcatgatctgacagtgtgttgttgtgc

agGGCTGCTCTTCAGAAGGTGCGGGATGCCTTCGCTCAGCAGGTGTTTAC

TGTCGTGCAGCTCTATGAGAAAAACACAGACGCTCTGGACATCAGCGTGT

GCGTCTCCAGATCAGCCGTCTCTCCTTCAGTCTCAGACATGCTGGAGTGG

CTTCAGGACGCCGACCGATATTACCGCCTGCAgtatccttcacttctcca

tcagccaagtgctggataaagatattgtccctcaaatgaaggattgcatt

aaaaaggcattatgttttgaaatctttggtcttactttatattagatggc

cttaactatgatatacttgcatcaaaaaaataaatatagtgtatttagtg

tgatggtaaactatcgcaggacacttgtggtgctcttgaggtgggataca

ggtctggtttgggacagattgggtggtattggtgggtttaagggtgggtt

aaggtgtaaagtatggtcaacagggtattttaaatgtaattacatgcagg

tatttaatcagaatgtcaaaaaaaacaacattcagtttaagtacatatta

gttaaggccacctaatagaagtttaacctgctactgatctacaataacac

aatcaaaacaagtaatttgcataatccccgcctctttttttattaatcat

ctgttttgtgatcaatcctatattttgtattggaggctcatctctgttcg

tgtgtgtgtgtattcctgaactgatgtgtcagATTAATGCAAAGCCGGCT

CCTCCTTCAGACGCTGACCCCCACTGACCTTACATCAATGGAAACAGCAC

CAAATAGATGGAGATCTCTGCGTTCTGCCCGTCAGGAGGAGAGAATTGCA

Ggtatatccctgtattacagcagcagatatggttacacactggccccgcg

ttcagctggtgttgagttaacgtctgtgatggggatcaagttacaagcat

aggacattctgtaatgccgtcagtccctctctccacaaatgctcatttaa

ccctttaacgttttgaccacagacatgaaaagaacttaaatgatcgtcag

tgttcaatgcttgtagatttaggcttggtttcattttaaaaatagatgt