ATPase, H+ transporting, lysosomal, V1 subunit E isoform 1

cDNA: Genbank AF506222

 

hi577a is in the 5' UTR

 

agaatcagctgatccctCCAGTCTATTTTCACGGCTCTGACACTGTCACG

ATCAACCCTTTTCGAGTAAATTTAAAATCTAAAGGCTTTCAGGATTATTT

TCGAGCTGTATTTGCAAAGCAGACGCCTTTCCTCTGCCACAAACCGAGCT

TTATCTGTCGGCGGAGTTTAAAATCCCCTT

hi577a (5-3)

AAAGCAGCAGGAGCAGGATCTGCAGTCATGGCGCTCAGCGATGCCGACGT

CCAGAAACAGgtgaaaacgctttaaaatgtattgttttaccttcactgca

gcttaataacagagtaaaattgacaatgaagtgctttgctcgatgtatta

ttccatacgagcctgacaggagtgtcgtgatgttctgacgaggccttcaa

ggttgttcgtcatttattcattacacacgcgcgtctgtcacgagacctgc

ctctattataattatagcagcacgtttattaaattattttaaattacatt

atattgcataggatgaccattgagtacgtaaataattaacaatgtcaaat

ttagaatgttcaaatgcatcaaatctgcgaataatagtatacaatattaa

taacaacaagacagagtgtaacgttagattcatattttgtaatatgaatg

attatctatctttaataacagacttaaagcttcgactcgtcgccgtcgac

c