40S ribosomal protein S5

cDNA: Genbank AF506223

 

hi577b and hi1364a are both in the 1st intron, before the ATG

 

tgaattgaagaagaagaagaaggcacgactcggaagtgcattgagcggaa

gtggtttttttctcgctcctcgtgtcgctcttcctttccgcctgCTCGAG

TGCGCCATTCACACACACGCTGCGAAGgtaacgctagaaaacatgtttta

aagcttttatatctctgtttccctcaccaaagtatacgaaaacggctgtt

aacaaccttatttgcgtgttttaacctgaatatcgcaaatatgtgtggtc

aaaatgatgagtttgagcgtctttataagccgtccatgagccgctgtctt

tcccgaagaagaccaagagcgaacccgcatgcctgagtgcagacagcttg

tttgttttgtattat

hi1364a (3-5)

ttttttaggtattagttaacttgtatgcatatttttggttttctgcttga

atttgaatgtaccaaataaataaattgttggcttgtagtaatgttgtgtc

atagacatcagattgtgatgtattttaatgtccctccaagtaaattgtgc

ttcgttcataatagactttgagttttgctaaatatttatattaaggttac

cgctaatatgtaaagcaattaagacagtcttgatagtgtagcttctgttt

ggattattaaat

hi577b (5-3)

gtgatcctgaaacattcactaagccttatgtttcatgttgcaaaatgttt

ttgggaaagccaaaaatacgttgtatgggtcaatataatgtaattaattt

atgcttaaagagttcaaattaaaagtttaggcatttagcaaagttctttt

cctgaatcaatctaaactgaatagttagtaatgtgttgctcaaaatagga

tttttgacaactttaaaggtgatttttctctctctattttcaaatcctct

gattcaagattttcaagttgttgtaaatgctctcctattttaacaaatta

catgaatggaaagcatttttctaaatatgaatctgcatttccaaatatga

aaaccaaatatgactactttcgtgatctattgaggtaaagttgcatttat

atattcgcacatttgttcagtatcttattttctccttaataataattcca

ggaaagagctaattctaaatggggaaatcatattagcagccaatgactat

aaaagtattgtttacagtctatccaataatgctaatgttgttttaaagtc

ttacactcagtacatgcgatttcagactgaatatccgatttagaatgcta

agcattatagggaccgctttacaatttgtcaataaacatatgagcgaata

taaacccaactttacctcaatttgatcagtgacaacttgtgacatgctcc

atatattgtatagtgaaatcatattagcagccaatgactgaaatgaatga

aataattctaatgttttgaagtcatacttgcatgtgaatttaaactgaat

attcaaagtactttggttatcaattaatagaggaaagttggttttaaatt

gagacattcgttcagtgatgacttgtggcatgctccctttattgtttatc

atggcactttgaagatttagtctgaaatcacatgcaactatgacttgaaa

acaacattagcactgtttatttgactgtgagcaatgttgtactttaatag

tcattggctgctaatattatttctctatgtagaatttgcaaaagatactt

aactgaaattatattattgagaaagtctgaatgggtgagtatattaactt

tatctcaattcgtgatttatggtcacagatgtttgtgagggcttgtgtta

atgtctccttacagaaatattctttactttcctctaaagATGGCTGAAGA

TTGGGAGGCTGCACCAGCTGTTGCTGAAACCCCAGAGATCAAACTCTTTG

GCAAGTGGAGCACAGATGATGTACAGATCAATGACATCTCCCTGCAGgta

tggtggacaaatgtgatatgaagttttgtcaagtttgattaggtgtgata

agtttgaaaatcgccttttaaagtacaatttgttgaacacttagatgaga

tatttatgcattaatactttaatccttaaaaataagtcaaactgttttag

atttttctcatgcatttattgttgtttatgtccttattgttttgaactgt

ttattatagataagtgtttaaacttagagttatttctctaaacaggtaat

tctg