arsenate resistance protein 2

cDNA: Genbank AF506224

 

hi591, hi2249, and 2765 are all in the 1st intron, before the ATG

 

gatctgagtatccgcaggtggaaatagagaataaagtatataagtagcgta

gctgctgttcatagattatttgatagtaaatgtcaatgcaaaaaggaagt

gctataaatgaaaataaaaactaacatgtaaagcttatgagtatttttcc

aatagaatgtctggtgcattaaacaactaaaataaaaactcaaacaaata

tatcactggtcaataatggttattattcttaaataattaaacatttaaga

cttttaacaaattttaaaagcgattttaactgcggtcatcctgtcactga

gtggcgcagtgcttccgtatactaacttccggtgccGCTCCGTGTGGACA

GTCGTGCGCTGGCGGGAGTTTGCCGGATTAAAGCCGTTTAAAACGAAGAA

ATCGgtcagtacttgacattacaacgctattttaatttttaacggctcaa

attgacataaaagaagtgttataaattataataatcgaatgtgtgccttt

ttatt

hi2765 (5-3)

acggttatctactgttttccttacataactcgccggaggcttcatgaaac

acgccgtgtgtgctgcta

hi2249 (5-3)

at

hi591 (3-5)

atttgatttttcttctataaacatgaattacatcacatatcctgtcgatt

tctataatgtgtatccatttacacttcacttattgtcgccgattgctgaa

ttattgagctcgactcggctgtaatgctagcatgctagaatcattagctt

cctattgtgtgtgttaatcgatcagaattgtgtaactgttgttatatcct

gcgtttaatcaacatatctgcattaagatgaaattagtctgtgtataagt

gacgcggagagatttgaaagttatgtggtttgtgaattgtctatatttac

agtctcattgaggtaaacttggtttattaatcgcacattcgttcgttaac

agctccaatattgtttaccaagctaatttgtatattctgtctataatcgc

atttaagtatgacttccatatcattagtacgatataactgactatgaact

atgtactctgatagtcattggctgctaatgacttcccgattttgaatttg

caaataaaacttctctaaaatatgttttattaaggagaaagtcagaatgt

gcgaatattaaaccaacgttgcctcaattactgtctatcagtactgagct

cttttgtttctactctcgtgtcaatcacagCAAAGCTTTCCTGAAACTCG

GCCTTCACTGAAACACAATGGGCGACAGTGATGACGAGTACGACCGCAGA

CGCAGAGACAAGTTCCGCCGGGAGAGGAGCGACTATGACCGGTCCAGGGA

GAGAGAGGACCGCCGTAGGGATGACTGGAATGACCGgtgagggagaaaga

tttaatcttgtgaaatataaataatagtcagaatttattaccgtgtgctt

acacacacaagggattagttttaaacagagatgcagttactcacaaagct

ctg