small nuclear ribonucleoprotein D1

cDNA: Genbank AF506225

 

hi601 is in the 1st intron

 

agctttcattatattatagtatcttatttattcattatctacaataaaca

gtattttggagcttcactttgatatgaaaatgacactacatgaaaaattg

tctaaatttaaagctgtattatacttttattatcttaaaacacaagtaaa

gccttaaatatgggtattattgctgttttggtttaataaaagtgtgtttt

tattaacctatttactgtatcgtcactgtggggttgccagatacgttaaa

actaaatctattccggtggatgttgaatgctatttttttgaattaagaaa

atataattacaaagaaaaaaacagaataaagttaatattttattatagta

tatttttattcatagtctaaaataaatcatattttgtagctgcgctgtga

tatggaaaagatttaaacatttatgaaaaaaaagtgtcaaaatttaaatc

tgtattatacttttattatcttaaaacgcaattgaagccttaaatatgat

taatattgctgttttggttttttaaaagaatgctttaaggaaactattta

ctgtgagattaaattattgttgttttggttaattaaaagtgtatttttat

taacctatgtaccatgagatatcgaaattgaaaaatacttttaagctatt

atcataataaaaattgttgtagcaacatttaaaattttaaattcgctttt

gtatgtttataacatgcttataaatgaaattaccagcgtgtaaaaatatt

ccggtgattttgttgagtaatggcaacccttctgtcctcagaattctgtt

tccctttcacccaggaagtgattgtaccatctctccagtagcgtcctaca

ttcGTTTTGCGCTACAATTTTTTCTCATCTAGGTGGAGGATTTTCTCTCA

AAGTCCACCGCCATCATGAAACTCGTCAGgtaataaacatctacagctgt

catacaa

hi601 (5-3)

gtaaaatacacaaagaaactttgcggatgcgcgatgtattttaatagatg

gagccggattgtgtgtagctgctagttagccgttagcttcatcaggcggg

aatgaatgaatgggcgagcgtttgtttgaacgttttactcatttgtttta

agcacatacgtgttttaaactatgtaataagcgggtttagtcttagatta

ttaatacattgtgcgttttttggtggtagtttgatcatgcggggtcttaa

atgcaacaaatacataaacagaaacaataactgttaatgctaagttagct

acatttatttactagtttctaaatatgctagctgtatataatcatataat

tatgttaatagacactatagtgtgtagttaggaagtctaaagattattgg

atatatagtttatcatttgttttaaatatagttatcagtttattatcatt

agtaagctgtaaatactttatataatcatattgacaaaatgctttatatg

tagatattagacgttatgttattataattgtttatcattgtttttatgat

tgtgacctgcagGTTTTTGATGAAATTGAGCCATGAAACCGTCACGATTG

AGCTGAAGAATGGCACACAGGTCCATGGCACAATTACAGgtaattattat

tttaagtaatgcaccataatcacatttataaactgtctgctatgtgcctg

tttcattaaatgaggtcatattatgcat