c4orf9 (nop14-like)

cDNA: Genbank AY648711

 

hi63 is in the 2nd exon

 

ttttccagagGAAGGAGACTCTCCTGAAAGAGTTGAAGGTGAAGGGCAAA

AGCAACAAGTTCATCGACCGGCGCTTTGGAGA

hi63 (5-3)

GTACGACAGTAAACTGAACCTCGAGGAGAAGATCCTGCAGAGGTTCACAC

TCGAGAGACAGgtcagcagcagcagcagcagcagcattactgttaccagc

agcactatgcatgtgtgtgtttgtgcatgtgtgtgtttgtgtttatgctt

gtgtgcatgtgcaagtgtgtgtgtatttgaatgtgtatgtgtgtgaatgt

tagtgtgtgtacatgcatgtatgtgcatgtgagtatgcatgtgcgtgcat

gtgtatgtgtgcatgcttgtgtgtgtgtgtgtgtatatttgtg