ribonucleotide reductase M2

cDNA: Genbank NM_131450 (5 end of alternate promoter/first exon AW280665)

 

hi1706 is upstream of the main transcript, but in the 5' UTR for an alternate promoter/first exon

hi688 is in the 1st coding exon

 

MAIN TRANSCRIPT (NM_131450)

 

cgacgagtcgactagttgtaaaatacgttttccgcttaatttgagttgtt

ttttttatatgtcgagtttaaaaataatcaacaaagtccgttggagttcg

tgttaacggtttagttgtggtgaagaactggctaaacagctgagagatta

ttgtggtgtaaagtttgatcggcaataaaatactgacacctctttgatga

cagtaaatgttatattaatgatgtggtattagtgatattattgatgtcca

atatacgttaatcttcgtgctgaaggacaggagaaacgacaacaagacat

ttacctctgtcatacggaggat

hi1706 (3-5)

ttgatgaaggtataatcacaaaagatcacacgtgcagtttcatgttcatt

attgaacgtgaatattgaagctttctaaagtattttaggttagagtatga

cttgatgttgtgtatttcgaaaatgtttactcaaatcggggcgcgaaacc

gcatcttcctgtcaggcgggttttgttgttgcaaatgggtttatgtctgc

cacgttataaaagaggtacggagaaatgtatttccccaaacaacagtcga

ttgtttttattatacaagatataattatcttaaaaacgtttattgtgctt

cgtttattgtgtcatttgtatgtgatcgacagctgcagtctttgtgactt

gaataaattcactgatagttaacgttacatgctttatttacttctaattc

agtaattttgctttgaaataataacagatgcaagcacatcagtgtaaagg

acatctacggtaacagaaaagacatctacggtatataaaccgtttacttg

agtgtggagtaaaattatacacatttattaaagtatatcgaacataaaaa

taaaaacattaagatttcacaaatgtatagttttatttcatattcgcgcc

cttttaaacctgtttgtatggttttgtaatactttgcaacccccaacatg

tttgaatttcccgcgaggtgcagctcttacgtgacgcggtggagaaatct

gattggttcatctgatgaacgagttaaaaggaccaaacaaagccggggag

tttgctctttccccattggctgagaataagcgccaagaatcgaatataaa

aagcgtatccggcattcatacctaGTGTTATCTTCGCTTCAGCTGGACCG

TAGACCTGCTAGCTCTTAGTTTTGCTTTTATTTATTTCTAGTTAACTTTG

TTTTAGAAGTTGTCTTTATTTTTAACCTTTAACTTATCCTCGTTTTGTTT

TACCAAACACTCCAAGCTTTACAATGTCGTC

hi688 (5-3)

CACTCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTCTACTAAAA

TGAATAACATGTCCTTTGTGGACAAAGAAAACACGgtaagtttgtttctt

tgactttacttttaacgaaccgcaattattgtaactactgcgtagtcatg

cgacccgtaagttacatttttaggctctcaagagtagctctatacgcgca

tataacataaaatacgtatattactttaaatacagctactaggtagttgt

gttgtgttgtaaaatgtgatttgttttgtcctcagCCACCCAGTTTGAGC

TCCACCAGAATCCTGGCGTCCAAAACGGCGCGCAAAATCTTTGATGAATC

AGAGgtcagtccacttttacttcgtctctgcacgtgtcttcagaatgagc

taatattatgcatgtttatctgatgtggtattaaatgtttatcgacttct

ggagcgatgtctttaagttgtagataaaatttggcggattctgagcgcgc

taagttgggcaggtcacatcaaacttatccgggtctttttggaagaacaa

tggctcattaaactagtccagctgaacggaatataaaacgattacttaaa

actagggtgatttttgtgttttatgctagttaataaaacaatgcatgagt

ttggcgggcgattagcttgagctgatgtaatgttgcataaaccgacgcca

aagtgtatgctaaacatgcactttaaaggtgcgaatacttccttttctgt

ccaattcgatcaataatttaagaagggtttcttatattttgcacaacttg

ggctggtcaatcaaaaaaagctcttggtttgcccaaaaaaaatta

 

 

ALTERNATE PROMOTER (AW280665)

 

cgacgagtcGACTAGTTGTAAAATACGTTTTCCGCTTAATTTGAGTTGTT

TTTTTTATATGTCGAGTTTAAAAATAATCAACAAAGTCCGTTGGAGTTCG

TGTTAACGGTTTAGTTGTGGTGAAGAACTGGCTAAACAGCTGAGAGATTA

TTGTGGTGTAAAGTTTGATCGGCAATAAAATACTGACACCTCTTTGATGA

CAGTAAATGTTATATTAATGATGTGGTATTAGTGATATTATTGATGTCCA

ATATACGTTAATCTTCGTGCTGAAGGACAGGAGAAACGACAACAAGACAT

TTACCTCTGTCATACGGAGGAT

hi1706 (3-5)

TTGATGAAGgtataatcacaaaagatcacacgtgcagtttcatgttcatt

attgaacgtgaatattgaagctttctaaagtattttaggttagagtatga

cttgatgttgtgtatttcgaaaatgtttactcaaatcggggcgcgaaacc

gcatcttcctgtcaggcgggttttgttgttgcaaatgggtttatgtctgc

cacgttataaaagaggtacggagaaatgtatttccccaaacaacagtcga

ttgtttttattatacaagatataattatcttaaaaacgtttattgtgctt

cgtttattgtgtcatttgtatgtgatcgacagctgcagtctttgtgactt

gaataaattcactgatagttaacgttacatgctttatttacttctaattc

agtaattttgctttgaaataataacagatgcaagcacatcagtgtaaagg

acatctacggtaacagaaaagacatctacggtatataaaccgtttacttg

agtgtggagtaaaattatacacatttattaaagtatatcgaacataaaaa

taaaaacattaagatttcacaaatgtatagttttatttcatattcgcgcc

cttttaaacctgtttgtatggttttgtaatactttgcaacccccaacatg

tttgaatttcccgcgaggtgcagctcttacgtgacgcggtggagaaatct

gattggttcatctgatgaacgagttaaaaggaccaaacaaagccggggag

tttgctctttccccattggctgagaataagcgccaagaatcgaatataaa

aagcgtatccggcattcatacctagtgttatcttcgcttcagctggaccg

tagacctgctagctcttagttttgcttttatttatttctagttaactttg

ttttagaagttgtctttatttttaacctttaacttatcctcgttttgttt

taccaaacactccaagCTTTACAATGTCGTC

hi688 (5-3)

CACTCGCTCTCCCCTGAAAACCAAGAATGAAAACACAATCTCTACTAAAA

TGAATAACATGTCCTTTGTGGACAAAGAAAACACGgtaagtttgtttctt

tgactttacttttaacgaaccgcaattattgtaactactgcgtagtcatg

cgacccgtaagttacatttttaggctctcaagagtagctctatacgcgca

tataacataaaatacgtatattactttaaatacagctactaggtagttgt

gttgtgttgtaaaatgtgatttgttttgtcctcagCCACCCAGTTTGAGC

TCCACCAGAATCCTGGCGTCCAAAACGGCGCGCAAAATCTTTGATGAATC

AGAGgtcagtccacttttacttcgtctctgcacgtgtcttcagaatgagc

taatattatgcatgtttatctgatgtggtattaaatgtttatcgacttct

ggagcgatgtctttaagttgtagataaaatttggcggattctgagcgcgc

taagttgggcaggtcacatcaaacttatccgggtctttttggaagaacaa

tggctcattaaactagtccagctgaacggaatataaaacgattacttaaa

actagggtgatttttgtgttttatgctagttaataaaacaatgcatgagt

ttggcgggcgattagcttgagctgatgtaatgttgcataaaccgacgcca

aagtgtatgctaaacatgcactttaaaggtgcgaatacttccttttctgt

ccaattcgatcaataatttaagaagggtttcttatattttgcacaacttg

ggctggtcaatcaaaaaaagctcttggtttgcccaaaaaaaatta