deltaA

cDNA: Genbank NM_130954

 

hi3499 is in the 5' UTR

hi781 and hi840 are both in the 2nd exon

 

 

cctcgctccagatacaaacgcacagtgtCGGCGGGAGAAGGACGTGAGGA

GGGATGTTGGACCAGTGACGAACCCTGGTTTGATATCAGACGAGAAGGAA

CTATACA

hi3499 (5-3)

CGACGAGCATCTGTCCTACTTTTCTTCTCCGACATTTGAGGATTATATAT

CACGGAATTCAACAAGTCCGTTTTACTTCAGGACTTTCTGGACTCT

TTTTTTTTTTTTCTCCCGGGGAAAAACTGTTGCATTGTGCGCACTTGACA

TGAATGGGAACTGCGTTCACGCTCAGTCTGTACTGAATGCAAGTCTCCAC

CAATGAATCAGTCGGCGAAAAGAGAAGCTTTTAATACAAGGGATCCCCTG

ACTGATCTGAGATCAGCCAAGTTGCTCAGAGACTTTCACAAAATCCTATT

TATTTATTTATTCATCATGGGACGCCACTTACTGTTGCTCCTCTTCTCCA

TCCTCTACATGCTGCTCTGCCAGgtaagcactcaagtcagattaaagtcc

ttgtaggttattggcattattagatctaatattcacacattggttgttct

ccagGCGTCCTCCTCAGGCGTCTTCGAGCTCAAGTTG

hi781 (3-5)

CAGGAGTTTTTAAACAAGAAGGGCGTGCAAGGGAACAAGAACTGCTGTAA

AGGTGGACTGACCACCTCTTACCAGCAGTGCGAGTGCAAGACTTTTTTCC

GCATCTGCTTAAAGCATTA

hi840 (5-3)

TCAGCCCAATGCATCTCCAGAGCCGCCCTGCACTTACGGAGGCACCGTCA

CCCCTGTGCTGGGCTCCAACTCTTTCCAAGTGCCAGATACCTTACCGGAT

GGCTCTTTCACCAATCCTATCAGGATGAATTTCGGTTTCACGTGGCCGgt

gagtaatgctgctgcattgacttggggaaattaatcctaaagcgatgttt

tgcacaattcctgattgctgtttttgctattttagGGAACTTTTTCTCTT

ATAATCGAAGCACTGCATGCTGACTCCAAAGAGGATCTGACAACAGgtat

gtgatctgatagcagaatgatgcattagttcatattatatagattatagt

cgactgaatgcatgaatgttctgtacagAAAACCCAGAGCGCATCATCAG

TACCATGACCACACAGAGGCACTTGACTGTGGGTGAGGATTGGTCTCAGG

ACCTGCACAGTGTGGGACGAACCGAGCTCAAGTACTCCTACCGTTTTGTG

TGCGACGAACACTACTATGGTGAAGGATGCTCAGTGTTCTGCCGGCCCAG

AGACGATGCATTCGGTCACTTCACCTGTGGAGAACGTGGAGAAATCATCT

GCGATGCTGGGTGGAAAGGCCAATACTGCACAGAACgtgagtacttatat

ttaatataacaatcattgca